01 July 2008

bye ! bye ! my private web server !

I'm about to leave my current job. Thus, soon or later, the web server where I stored my stuff will diseappear. Most of those items have been introduced on this blog.



Pierre

10 June 2008

Pubmed, impact factors, sorting and FriendFeed

I recently said on twitter that I wished I could sort the articles on pubmed using the impact factors of the journals. What followed was a demonstration of the power of friendfeed and was also observed under some other circumstances by Deepak Singh, Pedro Beltrao and some others... Within a day several persons joined the conversation on friendfeed and among them, Lars Juhl Jensen and Deepak suggested me to have a look at http://www.eigenfactor.org where the Eigenfactor is a measure of the journal's total importance to the scientific community. I must also cite Euan who was inspired by this discussion and created PubmedFaceoff, a photorealistic variant of the Chernoff Faces visualization technique based on pubmed.

Now let's go back to my sorting problem: I've joined the data from www.eigenfactor.org (with the kind permission of Carl Bergstrom) and from http://www.ncbi.nlm.nih.gov/entrez/citmatch_help.html#JournalLists and I've uploaded this new dataset on IBM-ManyEyes:



I wrote a java program reading a set of pubmed articles formatted in XML and using the scoring dataset. The algorithm is trivial: the XML element of the articles are removed from their parent node, sorted on their 'eigenfactors' retrieved from the journal <NlmId>, and then inserted back.

The source is available here

The executable jar (containing the scoring dataset) is available here:


Here is an example: I want to sort the articles about Charles Darwin. I've feched all the 372 articles in XML from this query
java -jar lindenb/build/sortpubmed.jar ~/pubmed_result.txt > result.xml

Here are the first articles:

    * Schmidhuber, Jürgen (Apr. 2008). "Comparing the legacies of Gauss, Pasteur and Darwin". Nature 452 (7187): 530. doi:10.1038/452530b. PMID 18256649. 
* Padian, Kevin (Feb. 2008). "Darwin's enduring legacy". Nature 451 (7179): 632-4. doi:10.1038/451632a. PMID 18305520.
* Odling-Smee, Lucy (Mar. 2007). "Darwin and the 20-year publication gap". Nature 446 (7135): 478-9. doi:10.1038/446478a. PMID 17392756.
* Oliveira, João Gama; Barabási Albert-László (Oct. 2005). "Human dynamics: Darwin and Einstein correspondence patterns". Nature 437 (7063): 1251. doi:10.1038/4371251a. PMID 16724015.
* Kohn, David; Murrell Gina, Parker John, Whitehorn Mark (Aug. 2005). "What Henslow taught Darwin". Nature 436 (7051): 643-5. doi:10.1038/436643a. PMID 16079834.
* Ridley, Matt (Sep. 2004). "Crick and Darwin's shared publication in Nature". Nature 431 (7006): 244. doi:10.1038/431244a. PMID 15372004.
* Gruber, J W (Oct. 2001). "Owen was right, as Darwin's work continues". Nature 413 (6857): 669. doi:10.1038/35099725. PMID 11449244.
* Padian, K (Jul. 2001). "Owen's Parthian shot". Nature 412 (6843): 123-4. doi:10.1038/35084289. PMID 11606991.
* Rhodes, F H (. 1983). "Gradualism, punctuated equilibrium and the Origin of Species". Nature 305 (5932): 269-72. PMID 6353241.
* Maynard-Smith, J (Apr. 1982). "The century since Darwin". Nature 296 (5858): 599-601. PMID 7040979.
* "Darwin's questions" (Jan. 1969). Nature 221 (5178): 313. PMID 4884839.
* Hector, Andy; Hooper Rowan (Jan. 2002). "Ecology. Darwin and the first ecological experiment". Science 295 (5555): 639-40. doi:10.1126/science.1064815. PMID 11809960.
* Corsi (May. 1987). "Further Letters of Darwin: The Correspondence of Charles Darwin". Science 236 (4804): 988-989. doi:10.1126/science.236.4804.988. PMID 17812771.
* Schweber (May. 1985). "Darwin's Earliest Letters: The Correspondence of Charles Darwin". Science 228 (4701): 838-841. doi:10.1126/science.228.4701.838. PMID 17815024.
* Lewin, R (Aug. 1982). "Darwin died at a most propitious time". Science 217 (4561): 717-8. PMID 7048528.
* Gould, S J (Apr. 1982). "Darwinism and the expansion of evolutionary theory". Science 216 (4544): 380-7. PMID 7041256.
* Zirkle (May. 1964). "Charles Darwin". Science 144 (3619): 724-725. doi:10.1126/science.144.3619.724-a. PMID 17807061.
* Cholodny (Nov. 1937). "CHARLES DARWIN AND THE MODERN THEORY OF TROPISMS". Science 86 (2238): 468. doi:10.1126/science.86.2238.468. PMID 17815459.
* Leidy (Sep. 1929). "CEREMONY ATTENDING THE OPENING OF DOWN HOUSE, THE HOME OF CHARLES DARWIN". Science 70 (1810): 228-231. doi:10.1126/science.70.1810.228. PMID 17775389.
* Osborn (Jun. 1929). "GIFT TO DOWN HOUSE OF THE ORIGINAL LETTERS OF CHARLES DARWIN TO FRITZ MULLER". Science 69 (1799): 645. doi:10.1126/science.69.1799.645. PMID 17791947.
* Osborn (Dec. 1926). "A CONTEMPORARY OF CHARLES DARWIN". Science 64 (1669): 623-624. doi:10.1126/science.64.1669.623-a. PMID 17834475.
* Sampson (Sep. 1909). "LETTERS FROM CHARLES DARWIN". Science 30 (766): 303-304. doi:10.1126/science.30.766.303. PMID 17837456.
* Ayala, Francisco J (May. 2007). "Darwin's greatest discovery: design without designer". Proc. Natl. Acad. Sci. U.S.A. 104 Suppl 1: 8567-73. doi:10.1073/pnas.0701072104. PMID 17494753.

I'm looking for a job !

Hi all,
I've just given my letter of resignation to my current employer , thus I'll be free from my professional obligations on September 1st and from now on I'm looking for a new fascinating job combining biology and informatics near Paris, France. This blog is a proof of my passion and my motivation for this area of interest. Recruiters can contact me via e-mail ( plindenbaum at yahoo fr ) and consult my resume on linkedin at http://www.linkedin.com/in/lindenbaum.

Pierre Lindenbaum PhD




Après avoir remis ma lettre de démission à mon employeur actuel, je serai libre de mes obligations professionnelles à compter du 1er septembre 2008. Je suis donc à la recherche de toute opportunité d'emploi combinant la biologie et l'informatique dans la région de Paris. Ce blog étant une preuve de ma passion et de ma motivation pour ce sujet. Les recruteurs intéressés par mon profil peuvent consulter mon CV sur linkedin http://www.linkedin.com/in/lindenbaum et me joindre par mail à "plindenbaum at yahoo fr"

Pierre Lindenbaum PhD

27 May 2008

NCBI Blast+ XSLT => XHTML + SVG

This post was inspired by the article Processing and duplicons on human chromosomes sent by Paulo Nuin yesterday and the short discussion that followed on FriendFeed. Paulo described in this article how the processing tool was used to display an output of ncbi-blast.

Here I show how a XSLT stylesheet can be used to transform a Blast into a XHTML+SVG page.

The stylesheet described here is available [here]



Here is how it works, at the beginning we've got a blast output in XML (here the query was a murine histone vs the human genome)

<?xml version="1.0"?>
<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "NCBI_BlastOutput.dtd">
<BlastOutput>
<BlastOutput_program>blastn</BlastOutput_program>
<BlastOutput_version>blastn 2.2.5 [Nov-16-2002]</BlastOutput_version>
<BlastOutput_reference>~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jin
ghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~&quot;Gapped BLAST and PSI-BLAST: a new
generation of protein database search~programs&quot;, Nucleic Acids Res. 25:3389-3402.</BlastOutput_r
eference>
<BlastOutput_db>HumanGenome</BlastOutput_db>
<BlastOutput_query-ID>lcl|QUERY</BlastOutput_query-ID>
<BlastOutput_query-def>gi|34556456|gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complet
e cds</BlastOutput_query-def>
<BlastOutput_query-len>1680</BlastOutput_query-len>
<BlastOutput_param>
<Parameters>
<Parameters_expect>10</Parameters_expect>
<Parameters_sc-match>1</Parameters_sc-match>
<Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
<Parameters_gap-open>5</Parameters_gap-open>
<Parameters_gap-extend>2</Parameters_gap-extend>
<Parameters_filter>D</Parameters_filter>
</Parameters>
</BlastOutput_param>
<BlastOutput_iterations>
<Iteration>
<Iteration_iter-num>1</Iteration_iter-num>
<Iteration_hits>
<Hit>
<Hit_num>1</Hit_num>
<Hit_id>gnl|BL_ORD_ID|32</Hit_id>
<Hit_def>chr6</Hit_def>
<Hit_accession>32</Hit_accession>
<Hit_len>170975699</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>444.541</Hsp_bit-score>
<Hsp_score>224</Hsp_score>
<Hsp_evalue>7.76885e-122</Hsp_evalue>
<Hsp_query-from>209</Hsp_query-from>
<Hsp_query-to>580</Hsp_query-to>
<Hsp_hit-from>27883967</Hsp_hit-from>
<Hsp_hit-to>27884338</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>335</Hsp_identity>
<Hsp_positive>335</Hsp_positive>
<Hsp_align-len>372</Hsp_align-len>
<Hsp_qseq>ATGTCTGGCCGTGGCAAACAGGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGGTCTTCCCGGGCCGGGCTACAGTTCCC
GGTGGGGCGTGTGCACCGGCTGCTGCGCAAGGGCAACTACGCGGAGCGCGTGGGTGCCGGCGCGCCGGTATACATGGCGGCGGTGCTGGAGTACCTAACGGCCGAGATCC
TGGAGCTGGCGGGCAACGCGGCCCGCGACAACAAGAAGACGCGCATCATCCCGCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCAAA
GTGACGATCGCACAGGGCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAGACCGAGAGCCAC</Hsp_qseq>
<Hsp_hseq>ATGTCTGGGCGTGGCAAGCAGGGAGGCAAAGCTCGCGCCAAGGCCAAGACCCGCTCTTCTCGGGCCGGGCTTCAGTTTCC
CGTAGGCCGAGTGCATCGCCTGCTCCGCAAAGGCAACTATGCGGAGCGGGTCGGTGCTGGAGCGCCGGTGTACCTGGCGGCGGTGCTGGAGTACCTGACCGCCGAGATCC
TGGAGCTGGCTGGCAACGCGGCCCGCGACAACAAGAAGACTCGCATCATCCCGCGTCACCTCCAGCTGGCCATCCGCAACGATGAGGAGCTCAACAAGCTTCTGGGCAAA
GTCACCATCGCACAGGGTGGCGTCCTGCCCAACATCCAGGCCGTGCTACTGCCCAAGAAGACCGAGAGCCAC</Hsp_hseq>
<Hsp_midline>|||||||| |||||||| ||||||||||| || ||||||||||||||| | || ||||| ||||||||||| |||||
|| || || || ||||| || ||||| ||||| |||||||| |||||||| || ||||| || |||||||| ||| |||||||||||||||||||||| || |||||||
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| ||||||
||||| || ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>420.753</Hsp_bit-score>
<Hsp_score>212</Hsp_score>
<Hsp_evalue>1.1255e-114</Hsp_evalue>
<Hsp_query-from>580</Hsp_query-from>
<Hsp_query-to>209</Hsp_query-to>
<Hsp_hit-from>27890126</Hsp_hit-from>
<Hsp_hit-to>27890497</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>332</Hsp_identity>
<Hsp_positive>332</Hsp_positive>
<Hsp_align-len>372</Hsp_align-len>
<Hsp_qseq>GTGGCTCTCGGTCTTCTTGGGCAGCAGCACGGCCTGGATGTTGGGCAGGACGCCGCCCTGTGCGATCGTCACTTTGCCCA
GCAGCTTGTTGAGCTCCTCGTCGTTGCGGATGGCCAGCTGCAGGTGGCGCGGGATGATGCGCGTCTTCTTGTTGTCGCGGGCCGCGTTGCCCGCCAGCTCCAGGATCTCG
GCCGTTAGGTACTCCAGCACCGCCGCCATGTATACCGGCGCGCCGGCACCCACGCGCTCCGCGTAGTTGCCCTTGCGCAGCAGCCGGTGCACACGCCCCACCGGGAACTG
TAGCCCGGCCCGGGAAGACCGCGACTTGGCCTTGGCGCGGGCCTTGCCTCCCTGTTTGCCACGGCCAGACAT</Hsp_qseq>
<Hsp_hseq>GTGGCTCTCAGTTTTCTTTGGCAGCAGCACGGCCTGGATGTTGGGCAGGACGCCACCCTGTGCGATGGTGACTTTGCCCA
GAAGCTTGTTGAGCTCCTCATCGTTGCGGATGGCCAGCTGGAGGTGACGCGGGATGATGCGAGTCTTCTTGTTGTCGCGGGCCGCGTTGCCAGCCAGCTCCAGGATCTCG
GCGGTCAGGTACTCCAGCACCGCCGCCAGGTACACCGGCGCTCCAGCACCGACCCGCTCCGCATAGTTGCCTTTGCGGAGCAGGCGATGCACTCGGCCTACGGGAAACTG
AAGCCCGGCCCGAGAAGAGCGGGTCTTGGCCTTGGCGCGAGCTTTGCCTCCCTGCTTACCACGCCCAGACAT</Hsp_hseq>
<Hsp_midline>||||||||| || ||||| ||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||
|||| ||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
||||| || |||||||||||||||||||||| ||| |||||||| || ||||| || |||||||| |||||||| ||||| ||||| || ||||| || || || || ||
||| ||||||||||| ||||| || | ||||||||||||||| || ||||||||||| || ||||| ||||||||</Hsp_midline>
</Hsp>

(...)

</Hit_hsps>
</Hit>
</Iteration_hits>
<Iteration_stat>
<Statistics>
<Statistics_db-num>1</Statistics_db-num>
<Statistics_db-len>245522847</Statistics_db-len>
<Statistics_hsp-len>0</Statistics_hsp-len>
<Statistics_eff-space>5.13463e+12</Statistics_eff-space>
<Statistics_kappa>0.710605</Statistics_kappa>
<Statistics_lambda>1.37407</Statistics_lambda>
<Statistics_entropy>1.30725</Statistics_entropy>
</Statistics>
</Iteration_stat>
</Iteration>
</BlastOutput_iterations>
</BlastOutput>


And the XSLT stylesheet:
1 <?xml version="1.0" encoding="UTF-8"?>
2 <xsl:stylesheet
3 version="1.0"
4 xmlns:xsl="http://www.w3.org/1999/XSL/Transform"
5 xmlns:svg="http://www.w3.org/2000/svg"
6 xmlns:xlink="http://www.w3.org/1999/xlink"
7 xmlns:h="http://www.w3.org/1999/xhtml"
8 >


17 <!-- ========================================================================= -->
18 <xsl:output method='xml' indent='yes' omit-xml-declaration="no"/>
19 <!-- we preserve the spaces in that element -->
20 <xsl:preserve-space elements="svg:style h:style" />
21
22 <!-- ========================================================================= -->
23 <!-- the width of the SVG -->
24 <xsl:variable name="svg-width">800</xsl:variable>
25 <!-- height of a HSP -->
26 <xsl:variable name="hsp-height">10</xsl:variable>
27 <!-- total number of Hits in first blast iteration -->
28 <xsl:variable name="hit-count"><xsl:value-of select="count(BlastOutput/BlastOutput_iterations/Iteration[1]/Iteration_hits/Hit)"/></xsl:variable>
29 <!-- total number of HSP in first blast iteration -->
30 <xsl:variable name="hsp-count"><xsl:value-of select="count(BlastOutput/BlastOutput_iterations/Iteration[1]/Iteration_hits/Hit/Hit_hsps/Hsp)"/></xsl:variable>
31 <!-- query length (bases or amino acids ) -->
32 <xsl:variable name="query-length"><xsl:value-of select="BlastOutput/BlastOutput_query-len"/></xsl:variable>
33 <!-- margin between two hits -->
34 <xsl:variable name="space-between-hits"><xsl:value-of select="3* $hsp-height"/></xsl:variable>
35 <!-- height of all hits -->
36 <xsl:variable name="hits-height"><xsl:value-of select="$hsp-count * $hsp-height + ($hit-count + 1) * $space-between-hits"/></xsl:variable>
37 <!-- size of the top header -->
38 <xsl:variable name="header-height">50</xsl:variable>
39
40 <!-- ========================================================================= -->
41
42 <!-- matching the root node -->
43 <xsl:template match="/">
44 <!-- start XHTML -->
45 <h:html>
46 <h:head>
47 <h:style type="text/css">
48 body {
49 font-size:10px;
50 font-family:Helvetica;
51 background-color:rgb(150,150,150);
52 color:white;
53 }
54 </h:style>
55 <h:title><xsl:value-of select="BlastOutput/BlastOutput_query-def"/></h:title>
56 </h:head>
57 <h:body>
58 <h:h1>Blast Results</h:h1>
59 <h:div>
60 <h:h3>Parameters</h:h3>
61 <h:table>
62 <h:tr><h:th>Database</h:th><h:td><xsl:value-of select="BlastOutput/BlastOutput_db"/></h:td></h:tr>
63 <h:tr><h:th>Query ID</h:th><h:td><xsl:value-of select="BlastOutput/BlastOutput_query-ID"/></h:td></h:tr>
64 <h:tr><h:th>Query Def.</h:th><h:td><h:b><xsl:value-of select="BlastOutput/BlastOutput_query-def"/></h:b></h:td></h:tr>
65 <h:tr><h:th>Query Length</h:th><h:td><h:b><xsl:value-of select="BlastOutput/BlastOutput_query-len"/></h:b></h:td></h:tr>
66 <h:tr><h:th>Version</h:th><h:td><xsl:value-of select="BlastOutput/BlastOutput_version"/></h:td></h:tr>
67 <h:tr><h:th>Reference</h:th><h:td><h:a href="http://www.ncbi.nlm.nih.gov/pubmed/9254694"><xsl:value-of select="BlastOutput/BlastOutput_reference"/></h:a></h:td></h:tr>
68 </h:table>
69 </h:div>
70 <h:hr/>
71 <h:div style="text-align:center">
72
73 <!-- starts SVG figure -->
74 <xsl:element name="svg:svg">
75 <xsl:attribute name="version">1.0</xsl:attribute>
76 <xsl:attribute name="width"><xsl:value-of select="$svg-width"/></xsl:attribute>
77 <xsl:attribute name="height"><xsl:value-of select="$hits-height + $header-height "/></xsl:attribute>
78 <svg:title><xsl:value-of select="BlastOutput/BlastOutput_query-def"/></svg:title>
79 <svg:defs>
80 <svg:style type="text/css">
81 text.t1 {
82 fill:black;
83 font-size:<xsl:value-of select="$hsp-height - 2"/>px;
84 font-family:Helvetica;
85 }
86 text.t2 {
87 fill:blue;
88 font-size:<xsl:value-of select="$space-between-hits - 2"/>px;
89 font-family:Helvetica;
90 text-anchor:middle;
91 }
92 text.title {
93 fill:white;
94 stroke:black;
95 font-size:12px;
96 font-family:Helvetica;
97 text-anchor:middle;
98 alignment-baseline:middle;
99 }
100 line.grid {
101 stroke:lightgray;
102 stroke-width:1.5px;
103 }
104
105 rect.hit {
106 fill:none;
107 stroke:darkgray;
108 stroke-width:1px;
109 }
110 </svg:style>
111
112 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score1">
113 <svg:stop offset="5%" stop-color="red" />
114 <svg:stop offset="50%" stop-color="whitesmoke" />
115 <svg:stop offset="95%" stop-color="red" />
116 </svg:linearGradient>
117 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score2">
118 <svg:stop offset="5%" stop-color="orange" />
119 <svg:stop offset="50%" stop-color="whitesmoke" />
120 <svg:stop offset="95%" stop-color="orange" />
121 </svg:linearGradient>
122 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score3">
123 <svg:stop offset="5%" stop-color="green" />
124 <svg:stop offset="50%" stop-color="whitesmoke" />
125 <svg:stop offset="95%" stop-color="green" />
126 </svg:linearGradient>
127 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score4">
128 <svg:stop offset="5%" stop-color="blue" />
129 <svg:stop offset="50%" stop-color="whitesmoke" />
130 <svg:stop offset="95%" stop-color="blue" />
131 </svg:linearGradient>
132 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score5">
133 <svg:stop offset="5%" stop-color="black" />
134 <svg:stop offset="50%" stop-color="whitesmoke" />
135 <svg:stop offset="95%" stop-color="black" />
136 </svg:linearGradient>
137 </svg:defs>
138
139 <xsl:element name="svg:rect">
140 <xsl:attribute name="x">0</xsl:attribute>
141 <xsl:attribute name="y">0</xsl:attribute>
142 <xsl:attribute name="width"><xsl:value-of select="$svg-width - 1"/></xsl:attribute>
143 <xsl:attribute name="height"><xsl:value-of select="$hits-height + $header-height "/></xsl:attribute>
144 <xsl:attribute name="fill">whitesmoke</xsl:attribute>
145 <xsl:attribute name="stroke">blue</xsl:attribute>
146 </xsl:element>
147
148
149 <xsl:apply-templates select="BlastOutput"/>
150 </xsl:element>
151 <!-- end SVG figure -->
152
153 </h:div>
154 <h:hr/>
155 <xsl:apply-templates select="BlastOutput/BlastOutput_param/Parameters"/>
156 <h:hr/>
157 <h:p><h:b>SVG</h:b> figure generated with <h:a href="http://code.google.com/p/lindenb/source/browse/trunk/src/xsl/blast2svg.xsl">blast2svg</h:a>. <h:a href="http://plindenbaum.blogspot.com">Pierre Lindenbaum PhD</h:a> <h:i>( plindenbaum at yahoo dot fr )</h:i></h:p>
158
159 </h:body>
160 </h:html>
161 </xsl:template>
162 <!-- ========================================================================= -->
163 <!-- display parameters in a HTML table -->
164 <xsl:template match="Parameters">
165 <h:div>
166 <h:h3>Parameters</h:h3>
167 <h:table>
168 <h:tr><h:th>Expect</h:th><h:td><xsl:value-of select="Parameters_expect"/></h:td></h:tr>
169 <h:tr><h:th>Sc-match</h:th><h:td><xsl:value-of select="Parameters_sc-match"/></h:td></h:tr>
170 <h:tr><h:th>Sc-mismatch</h:th><h:td><xsl:value-of select="Parameters_sc-mismatch"/></h:td></h:tr>
171 <h:tr><h:th>Gap-open</h:th><h:td><xsl:value-of select="Parameters_gap-open"/></h:td></h:tr>
172 <h:tr><h:th>Gap-extend</h:th><h:td><xsl:value-of select="Parameters_gap-extend"/></h:td></h:tr>
173 <h:tr><h:th>Filter</h:th><h:td><xsl:value-of select="Parameters_filter"/></h:td></h:tr>
174 </h:table>
175 </h:div>
176 </xsl:template>
177
178
179 <!-- ========================================================================= -->
180 <xsl:template match="BlastOutput">
181 <!-- paint header -->
182 <svg:g>
183 <xsl:element name="svg:rect">
184 <xsl:attribute name="x">0</xsl:attribute>
185 <xsl:attribute name="y">0</xsl:attribute>
186 <xsl:attribute name="width"><xsl:value-of select="$svg-width - 1"/></xsl:attribute>
187 <xsl:attribute name="height"><xsl:value-of select="$header-height - 2"/></xsl:attribute>
188 <xsl:attribute name="fill">url(#score5)</xsl:attribute>
189 <xsl:attribute name="stroke">black</xsl:attribute>
190 </xsl:element>
191
192 <xsl:element name="svg:text">
193 <xsl:attribute name="x"><xsl:value-of select="$svg-width div 2"/></xsl:attribute>
194 <xsl:attribute name="y"><xsl:value-of select="$header-height div 2"/></xsl:attribute>
195 <xsl:attribute name="class">title</xsl:attribute>
196 <xsl:value-of select="BlastOutput_query-def"/> (len=<xsl:value-of select="BlastOutput_query-len"/> )
197 </xsl:element>
198 </svg:g>
199 <xsl:apply-templates select="BlastOutput_iterations/Iteration[1]/Iteration_hits"/>
200 </xsl:template>
201
202 <!-- ========================================================================= -->
203
204 <xsl:template match="Iteration_hits">
205 <xsl:apply-templates select="Hit"/>
206 </xsl:template>
207
208 <!-- ========================================================================= -->
209
210 <xsl:template match="Hit">
211 <!-- count number of preceding hits -->
212 <xsl:variable name="preceding-hits"><xsl:value-of select="count(preceding-sibling::Hit)"/></xsl:variable>
213 <!-- count number of preceding hsp -->
214 <xsl:variable name="preceding-hsp"><xsl:value-of select="count(preceding-sibling::Hit/Hit_hsps/Hsp)"/></xsl:variable>
215 <!-- calculate hieght of this part -->
216 <xsl:variable name="height"><xsl:value-of select="count(Hit_hsps/Hsp)*$hsp-height"/></xsl:variable>
217 <!-- translate this part verticaly -->
218 <xsl:element name="svg:g">
219 <xsl:attribute name="transform">translate(0,<xsl:value-of select="$header-height + $preceding-hsp * $hsp-height + ($preceding-hits + 1) * $space-between-hits "/>)</xsl:attribute>
220 <xsl:attribute name="id">hit-<xsl:value-of select="generate-id(.)"/></xsl:attribute>
221 <xsl:element name="svg:text">
222 <xsl:attribute name="x"><xsl:value-of select="$svg-width div 2"/></xsl:attribute>
223 <xsl:attribute name="y"><xsl:value-of select="-2"/></xsl:attribute>
224 <xsl:attribute name="class">t2</xsl:attribute>
225 <xsl:value-of select="Hit_def"/>
226 </xsl:element>
227 <xsl:element name="svg:rect">
228 <xsl:attribute name="x">0</xsl:attribute>
229 <xsl:attribute name="y">0</xsl:attribute>
230 <xsl:attribute name="width"><xsl:value-of select="$svg-width"/></xsl:attribute>
231 <xsl:attribute name="height"><xsl:value-of select="$height"/></xsl:attribute>
232 <xsl:attribute name="class">hit</xsl:attribute>
233 </xsl:element>
234
235 <xsl:call-template name="grid">
236 <xsl:with-param name="x" select="0"/>
237 <xsl:with-param name="d" select="20"/>
238 <xsl:with-param name="W" select="$svg-width"/>
239 <xsl:with-param name="H" select="$height"/>
240 </xsl:call-template>
241
242 <xsl:apply-templates select="Hit_hsps"/>
243
244
245
246 </xsl:element>
247 </xsl:template>
248
249 <!-- ========================================================================= -->
250 <!-- draw vertical lines , recursive template -->
251 <xsl:template name="grid">
252 <xsl:param name="x" select="0" />
253 <xsl:param name="d" select="20" />
254 <xsl:param name="W" select="0" />
255 <xsl:param name="H" select="0" />
256 <svg:line class="grid" x1="{$x}" x2="{$x}" y1="0" y2="{$H}"/>
257 <xsl:if test="$d + $x &lt; $W">
258 <xsl:call-template name="grid">
259 <xsl:with-param name="x" select="$d + $x"/>
260 <xsl:with-param name="d" select="$d"/>
261 <xsl:with-param name="W" select="$W"/>
262 <xsl:with-param name="H" select="$H"/>
263 </xsl:call-template>
264 </xsl:if>
265 </xsl:template>
266
267 <!-- ========================================================================= -->
268
269 <xsl:template match="Hit_hsps">
270 <xsl:apply-templates select="Hsp"/>
271 </xsl:template>
272
273
274 <!-- ========================================================================= -->
275 <xsl:template match="Hsp">
276 <!-- number of previous hsp in the same Hit -->
277 <xsl:variable name="preceding-hsp"><xsl:value-of select="count(preceding-sibling::Hsp)"/></xsl:variable>
278 <!-- get the 5' position of the hsp in the query -->
279 <xsl:variable name="hsp-left"><xsl:choose>
280 <xsl:when test="Hsp_query-from &lt; Hsp_query-to"><xsl:value-of select="Hsp_query-from"/></xsl:when>
281 <xsl:otherwise><xsl:value-of select="Hsp_query-to"/></xsl:otherwise>
282 </xsl:choose></xsl:variable>
283 <!-- get the 3' position of the hsp in the query -->
284 <xsl:variable name="hsp-right"><xsl:choose>
285 <xsl:when test="Hsp_query-from &lt; Hsp_query-to"><xsl:value-of select="Hsp_query-to"/></xsl:when>
286 <xsl:otherwise><xsl:value-of select="Hsp_query-from"/></xsl:otherwise>
287 </xsl:choose></xsl:variable>
288 <!-- 5' position on screen -->
289 <xsl:variable name="x1"><xsl:value-of select="($hsp-left div $query-length ) * $svg-width"/></xsl:variable>
290 <!-- 3' position on screen -->
291 <xsl:variable name="x2"><xsl:value-of select="($hsp-right div $query-length ) * $svg-width"/></xsl:variable>
292 <!-- label -->
293 <xsl:variable name="label"><xsl:value-of select="Hsp_hit-from"/> - <xsl:value-of select="Hsp_hit-to"/> (<xsl:choose>
294 <xsl:when test="Hsp_query-from &lt; Hsp_query-to">+</xsl:when>
295 <xsl:otherwise>-</xsl:otherwise></xsl:choose>) e=<xsl:value-of select="Hsp_evalue"/></xsl:variable>
296
297 <!-- translate this Hsp verticaly in its Hit -->
298 <xsl:element name="svg:g">
299 <xsl:attribute name="transform">translate(0,<xsl:value-of select="$preceding-hsp * $hsp-height"/>)</xsl:attribute>
300 <xsl:attribute name="id">hsp-<xsl:value-of select="generate-id(.)"/></xsl:attribute>
301 <xsl:attribute name="title"><xsl:value-of select="Hsp_evalue"/></xsl:attribute>
302
303 <!-- paint the Hsp Rectangle -->
304 <xsl:element name="svg:rect">
305 <xsl:attribute name="x"><xsl:value-of select="$x1"/></xsl:attribute>
306 <xsl:attribute name="y">2</xsl:attribute>
307 <xsl:attribute name="width"><xsl:value-of select="$x2 - $x1"/></xsl:attribute>
308 <xsl:attribute name="height"><xsl:value-of select="$hsp-height - 4"/></xsl:attribute>
309 <!-- choose a color according to the e-value -->
310 <xsl:attribute name="fill"><xsl:choose>
311 <xsl:when test="Hsp_evalue &lt; 1E-100">url(#score1)</xsl:when>
312 <xsl:when test="Hsp_evalue &lt; 1E-10">url(#score2)</xsl:when>
313 <xsl:when test="Hsp_evalue &lt; 0.1">url(#score3)</xsl:when>
314 <xsl:when test="Hsp_evalue &lt; 0">url(#score4)</xsl:when>
315 <xsl:otherwise>url(#score5)</xsl:otherwise>
316 </xsl:choose></xsl:attribute>
317 </xsl:element>
318
319 <!-- paint the label according to the position of the Hsp on screen -->
320 <xsl:choose>
321 <xsl:when test="$x2 &lt; (0.75 * $svg-width)">
322 <xsl:element name="svg:text">
323 <xsl:attribute name="class">t1</xsl:attribute>
324 <xsl:attribute name="x"><xsl:value-of select="$x2 + 10 "/></xsl:attribute>
325 <xsl:attribute name="y"><xsl:value-of select="$hsp-height -1"/></xsl:attribute>
326 <xsl:attribute name="text-anchor">start</xsl:attribute>
327 <xsl:value-of select="$label"/>
328 </xsl:element>
329 </xsl:when>
330 <xsl:when test="$x1 &gt; (0.25 * $svg-width)">
331 <xsl:element name="svg:text">
332 <xsl:attribute name="class">t1</xsl:attribute>
333 <xsl:attribute name="x"><xsl:value-of select="$x1 - 10 "/></xsl:attribute>
334 <xsl:attribute name="y"><xsl:value-of select="$hsp-height -1"/></xsl:attribute>
335 <xsl:attribute name="text-anchor">end</xsl:attribute>
336 <xsl:value-of select="$label"/>
337 </xsl:element>
338 </xsl:when>
339 <xsl:otherwise>
340 <xsl:element name="svg:text">
341 <xsl:attribute name="class">t1</xsl:attribute>
342 <xsl:attribute name="x"><xsl:value-of select="($x2 - $x1) div 2 "/></xsl:attribute>
343 <xsl:attribute name="y"><xsl:value-of select="$hsp-height -1"/></xsl:attribute>
344 <xsl:attribute name="text-anchor">middle</xsl:attribute>
345 <xsl:value-of select="$label"/>
346 </xsl:element>
347 </xsl:otherwise>
348 </xsl:choose>
349
350 </xsl:element>
351 </xsl:template>
352 <!-- ========================================================================= -->
353
354
355 </xsl:stylesheet>

Some random notes:
Line 22-38: I define a few variables such as the number of Hsp or the number of Hits
Line 43: matching the root., we start the XHTML document here
line 73: we start the SVG document here. It is embedded in the XHTML document
line 80-110: CSS can be used for SVG
line 112-137: we define a few gradients to colorize the Hsp. TODO: finding a better method to colorize according to its e-value/score
line 199: for the first iteration, the <Hit> templates are called
line 211: we need to count the number of preceding hits/hsp to know how much we should translate vertically this group of object
line 242: we loop over each hsp in this hit
line 276-292: again, we need to know the number of preceding hits/hsp to translate this hsp vertically. We also calculate the 5' and the 3' position of the Hit in the query.
line 304-307: here, we paint the hsp-rectangle
line 320-348: lousy method, we paint a label for this hsp, trying to find the best place (left/right/middle) to print the label.

The blast file was processed with xsltproc:
xsltproc --novalid blast2svg.xsl blast.xml > ~/blast.xhtml


A sample output is displayed below
blast2svg



Pierre

26 May 2008

Science!

SCIENCE !

25 May 2008

Leonard Colebrook: Creating a Biography in Wikipedia

Today I created a new article in wikipedia about Leonard Colebrook who was an " English medical researcher who introduced the use of Prontosil, the first sulfonamide drug, as a cure for puerperal, or childbed, fever, a condition resulting from infection after childbirth or abortion (Encyclopaedia Britannica)" (Let's be clear, I didn't know who was that guy till today). Here is how I wrote this article.
First of all, I logged into wikipedia using my login/password. In the article about the Prontosil, I clicked on the link "edit this page", added a reference about Colebrook.

... [[Leonard Colebrook]] introduced it as a cure for puerperal fever ...

and saved the page.

Clicking on this new link makes wikipedia open an editor for a new article. The wiki-code below is what I wrote (please not that, a few weeks ago I created to tool called XUL4Wikipedia, I use it as a source of shortcuts to edit such articles).



1 {{Infobox Scientist
2 |name = {{PAGENAME}}
3 |box_width =
4 |image =Replace_this_image_male.svg
5 |image_size =150px
6 |caption = {{PAGENAME}}
7 |birth_date = {{Birth date|1883|3|2}}
8 |birth_place = [[Guildford, Surrey]]
9 |death_date = {{Death date and age|1883|3|2|1967|9|27}}
10 |death_place = [[Farnham Common]], [[Buckinghamshire]]
11 |residence =
12 |citizenship =
13 |nationality = [[England]]
14 |ethnicity =
15 |field = [[medicine]]
16 |work_institutions =
17 |alma_mater = [[St Mary's Hospital, London]]
18 |doctoral_advisor =
19 |doctoral_students =
20 |known_for = [[Prontosil]]
21 |author_abbrev_bot =
22 |author_abbrev_zoo =
23 |influences = [[Almroth Wright]]
24 |influenced = [[Peter Medawar]]
25 |prizes = [[Blair Bell medal]] in [[1955]]
26 |religion =
27 |footnotes =
28 |signature =
29 }}
30 '''{{PAGENAME}}''' [[Fellow_of_the_Royal_Society|FRS]] ( {{Birth
31 date|1883|3|2}} – {{Death date|1967|9|27}}) was an
32 [[England|English]] [[physician]] who introduced the use of [[Prontosil]]
33 in [[1935]] as a cure for [[puerperal fever]].
34
35 ==References==
36 *{{cite journal
37 | quotes = yes
38 |last=Dunn
39 |first=P M
40 |authorlink=
41 |year=[[2008]]
42 |month=May
43 |title=Dr Leonard Colebrook, FRS (1883-1967) and the chemotherapeutic
44 conquest of puerperal infection
45 |journal=Arch. Dis. Child. Fetal Neonatal Ed.
46 |volume=93
47 |issue=3
48 |pages=F246-8
49 | publisher = | location = | issn =
50 | pmid = 18426926
51 |doi = 10.1136/adc.2006.104448
52 | bibcode = | oclc =| id = | url = | language = | format = | accessdate =
53 | laysummary = | laysource = | laydate = | quote =
54 }}
(...)
191 ==See also==
192 * [[Prontosil]]
193
194 {{Persondata
195 |NAME =Colebrook, Leonard
196 |ALTERNATIVE NAMES =
197 |SHORT DESCRIPTION = English physician who introduced the use of
198 [[Prontosil]] in [[1935]] as a cure for [[puerperal fever]]
199 |DATE OF BIRTH = [[23 December]] [[1961]]
200 |PLACE OF BIRTH = [[Guildford, Surrey]]
201 |DATE OF DEATH = {{Death date|1967|9|27}}
202 |PLACE OF DEATH = [[Farnham Common]], [[Buckinghamshire]]
203 }}
204
205
206 {{physician-stub}}
207
208 {{DEFAULTSORT:Colebrook, Leonard}}
209 [[Category:1883 births]]
210 [[Category:1967 deaths]]
211 [[Category:British physisicans]]




  • 1-29 (Infobox Scientist)and 194-203 (Persondata) are respectively an infobox and a source of metadata about individuals. I guess those structures can be parsed and interpreted by some other tools such as Freebase or DBpedia
  • .
  • 4: I could not find any picture of Colebrook on http://commons.wikimedia.org. I put this link to a SVG figure as I don't have any image. It is then possible to answer the question: "who is missing a portrait ?"

  • 7 and 9: these are templates (~macro) which format the date. The later template calculates and prints the age of the individual at his death

  • 36-190: I searched the references about Colebrook on pubmed using the query "Colebrook L[PS]" ([PS] stands for Personal Name as Subject). The nine articles found were saved as XML and transformed to wiki-code using xsltproc and my xsltstylesheet pubmed2wiki

  • 206:just a signal to say "this article needs to be improved". It is then possible to answer the question: "what are the medical biographies which need to be improved ?"

  • 208: this template is used by wikipedia to sort the results of a query

  • 209-211: "Categories provide automatic indexes that are useful as tables of contents. Together with links and templates they structure a project."



That's it
Pierre

16 May 2008

Twitter m'a tuer

Just like Paweł Szczęsny ( on http://freelancingscience.com), I'm using less and less this blog favor of twitter, especially for the short posts .

For example, yesterday I sent this information on twitter:

.

I'm also starting using friendfeed.


Image found here


Pierre

14 April 2008

Bio-Twitters, Unite !

If your a scientist, a bioinformatician, etc... join the scientific community of the biotwitters on http://twitter.com. Follow @biotecher to find all the biotwitters in one place (Thanks Attila !) and follow me on @yokofakun.

If you don't know twitter, here is a short video about it:


Pierre

04 April 2008

BerkeleyDB and Hapmap: My notebook.

I'm currently trying to find the best way to store some genotypes. For example I need to store 278.766.958 illumina genotypes (marker,individual, allele1, allele2) and mysql, even with indexes, is getting slow when I'm looking for the Mendelian incompatibilities. Deepak suggested via twitter to use href="http://hdf.ncsa.uiuc.edu/HDF5/">HDF5 but as far as I understand the documentation, HDF5 is "just" a smarter implementation of the C functions fseek/fread/fwrite.

I've been looking at the java implementation of the BerkeleyDB (BDB) just to watch its performance according to my needs. This engine can be used as en embedded database and doesn't need a database server running as a daemon (just like JavaDB). A BDB berkeley database contains records where each record contains a "key" and a "value" (a kind of two columns database, or a kind of C++ std::multimap). In the current post, I'll describe a program which 1) download some genotypes from HapMap 2) Find the pedigree of the samples 3) Loop over the markers (ordered on their position on the genome) and get the frequency 4) find Mendelian incompatibilities

The source code is available on pastie at:



First we need a few classes:

class Position holds a position on a chromosome
private static class Position
{
String chromosome;
int position;
Position(String chromosome,int position)
{
this.chromosome=chromosome;
this.position=position;
}
}


class Marker contains the informations about a snp :
private static class Marker
{
int rsId;
String alleles;
Position pos;
char strand;
}


class Individual contains the informations about an individual including his 'id' on corriel ( see http://cardiogenomics.med.harvard.edu)
private static class Individual
{
/**Coriell Repository Number*/
String name;
/** id in corriel */
String individualID=null;
/** father id */
String fatherID=null;
/** mother id */
String motherID=null;
}


As BDB is a collection of pairs(key,value) we need a class MarkerIndividual holding the pair(marker,individual) to store the genotypes with f(pair(marker,individual)=genotype.
private static class MarkerIndividual
{
private int rsId;
/**Coriell Repository Number*/
private String individualId;
}


At the end, we need a class Genotype to store two alleles:
private static class Genotype
{
char a1,a2;

public boolean same(char a1,char a2)
{
return (this.a1==a1 && this.a2==a2) ||
(this.a1==a2 && this.a2==a1)
;
}
}


BDB has several alternatives to read and write the java objects from/to the databases, this operation requires the object to be converted into an array of bytes: 1) the java Serialization can be used, 2) a TupleBinding can be implemented, this class must impements two functions which are used to encode/decode the object to/from an array of bytes. I've choosen to use this later option, and here is for example the TupleBinding implementation for the class Individual:

private TupleBinding individualTupleBinding=new TupleBinding()
{
@Override
public Object entryToObject(TupleInput input)
{
Individual indi= new Individual();
indi.name= input.readString();
indi.individualID= input.readString();
indi.fatherID=input.readString();
indi.motherID= input.readString();
return indi;
}

@Override
public void objectToEntry(Object object, TupleOutput output) {
Individual indi= Individual.class.cast(object);
output.writeString(indi.name);
output.writeString(indi.individualID);
output.writeString(indi.fatherID);
output.writeString(indi.motherID);
}
};


To open and create an Berkeley Environment the following code was written:
EnvironmentConfig envConf= new EnvironmentConfig();
envConf.setAllowCreate(!readOnly);
envConf.setReadOnly(readOnly);
envConf.setTransactional(false);
this.env= new Environment(
file,
envConf
);


Then, we open each database. We need 3 databases: markers, individuals and genotypes. Opening a Database looks like this:

DatabaseConfig dbConfig= new DatabaseConfig();
/* allow create if database does not exists */
dbConfig.setAllowCreate(!readOnly);
dbConfig.setReadOnly(readOnly);
Database db= this.env.openDatabase(null, "database-name", d
bConfig);


Althoug DBD is based on a pair(key,value) another component of the value could be searched and need to be indexed. This process is called a "Secondary Database". For example, with this project I created a secondary database:1) to find/loop over the markers using their position 2) to find/loop over the individuals using individualID instead of name. We need a class extending SecondaryKeyCreator
to extract this second key for the original value. For example here is the class extraction the Position from the Marker.
class MarkerPositionCreator implements SecondaryKeyCreator
{
public boolean createSecondaryKey(
SecondaryDatabase secDb,
DatabaseEntry keyEntry,
DatabaseEntry dataEntry,
DatabaseEntry resultEntry)
{
Marker marker= (Marker)Test01.this.markerTupleBinding.entryToObject(dataEntry);
Test01.this.positionTupleBinding.objectToEntry(marker.pos, resultEntry);
return true;
}
}

We also need to open those "secondary" databases
SecondaryConfig secondConfig= new SecondaryConfig();
secondConfig.setAllowCreate(!readOnly);
/* on open, if the secondary database is empty then the primary
database is read in its entirety and additions/modifications to the secondary's records occur automatically */
secondConfig.setAllowPopulate(true);
secondConfig.setSortedDuplicates(true);
MarkerPositionCreator posCreator = new MarkerPositionCreator();
/* Identifies the key creator object to be used for secondary key creation. */
secondConfig.setKeyCreator(posCreator);
positionDB = this.env.openSecondaryDatabase(null, "position
", this.markerDB,secondConfig);


OK, more genetic now. The HapMap genotypes are available here:http://www.hapmap.org/genotypes/latest/rs_strand/non-redundant/ (the path may change). A file looks like a table f(marker,individual)=genotype:
rs# SNPalleles chrom pos strand genome_build center protLSID assayLSID panelLSID QC_code NA18940 NA18942 NA189
rs28412942 A/T chrMT 410 + ncbi_B36 affymetrix GenomeWideSNP_6.02 Japanese:2 QC+ AA AA AA AA AA AA AA AA AA AA
rs3937039 A/G chrMT 665 + ncbi_b36 broad genotype_protocol_11 Japanese:1 QC+ AA AA AA AA AA AA AA AA AA AA AA
rs2853517 A/G chrMT 711 + ncbi_b36 broad genotype_protocol_11 Japanese:1 QC+ GG GG GG GG GG GG GG GG GG GG GG
rs28358568 C/T chrMT 712 + ncbi_b36 broad genotype_protocol_11 Japanese:1 QC+ TT TT TT TT TT TT TT TT TT TT TT
(...)


The file is processed as follow.

Pattern space=Pattern.compile("[ ]");
String HEADER[]=new String[]{"rs#","SNPalleles","chrom","pos","strand","genome_build","center","protLSID","assayLSID","panelLSID","QC_code"};
BufferedReader in= new BufferedReader(new InputStreamReader(new GZIPInputStream(url.openStream())));

String line= in.readLine();
if(line==null) throw new IOException("Empty file");
/* The first line of this file is the header*/
String header[]=space.split(line);
for(int i=0;i< HEADER.length;++i)
{
if(!header[i].equals(HEADER[i])) throw new IOException("Bad header "+header[i]+" expected "+HEADER[i]);
}
/* the header contains the name of the Individual which will be inserted. At this time we don't know what are the relationships between those individuals.*/
for(int i=HEADER.length;i< header.length;++i)
{
Individual individual= new Individual();
individual.name=header[i];
DatabaseEntry key= new DatabaseEntry(individual.name.getBytes());
DatabaseEntry data= new DatabaseEntry();
this.individualTupleBinding.objectToEntry(individual, data);
getIndividualDB().put(null
,key
,data
);
}
/** the following lines are the markers and the genotypes */
TupleBinding INT_BINDING=TupleBinding.getPrimitiveBinding(Integer.class);
while((line=in.readLine())!=null)
{
if(!line.startsWith("rs")) continue;
String tokens[]=space.split(line);
//System.err.println(line);
/* fill the information of this marker */
Marker marker= new Marker(Integer.parseInt( tokens[0].substring(2)));
marker.alleles= tokens[1];
marker.pos= new Position(tokens[2],Integer.parseInt(tokens[3]));
marker.strand= tokens[4].charAt(0);

DatabaseEntry key= new DatabaseEntry();
INT_BINDING.objectToEntry(marker.getRSId(), key);
DatabaseEntry data= new DatabaseEntry();
this.markerTupleBinding.objectToEntry(marker, data);
getMarkerDB().put(null
,key
,data
);
/** loop over this marker and get the genotypes */
for(int i=HEADER.length;i<header.length;++i)
{
if(tokens[i].length()!=2 || tokens[i].equals("NN")) continue;
/** create the KEY */
MarkerIndividual mi= new MarkerIndividual(marker.rsId,header[i]);
this.markerIndividualTupleBinding.objectToEntry(mi, key);
/** create the genotype */
this.genotypeTupleBinding.objectToEntry(
new Genotype(tokens[i].charAt(0),tokens[i].charAt(1)),
data
);
/** put the new pair( pair(marker,individual), genotype) in the BDB */
getGenotypeDB().put(null
,key
,data
);
}
}
in.close();


OK, I want to find the relationships between those individuals, this information is available here. For each "Coriell Repository Number" we find the individual in our database, if it exists we add the information and write the individual back to the database. (See function ">makePedigree line 466).

To retrieve the genotype g=f(marker,individual) I wrote the following simple utility function getGenotypeAt:

Genotype getGenotypeAt(Marker marker,Individual indi) throws DatabaseException
{
if(marker==null || indi==null) return null;
DatabaseEntry key=new DatabaseEntry();
DatabaseEntry value=new DatabaseEntry();
this.markerIndividualTupleBinding.objectToEntry(new MarkerIndividual(marker.rsId,indi.name),key);
if(this.genotypeDB.get(null, key, value, LockMode.DEFAULT)!=OperationStatus.SUCCESS) return null;
Genotype g= Genotype.class.cast(this.genotypeTupleBinding.entryToObject(value));
return g;
}



To get the frequencies of the alleles, we loop each over each marker (using a secondary database to get the markers ordered on the genome (not ordered on rs##)) and we get all the genotypes for each individual. To loop over a BDB an instance Cursor (looks like a java.util.Iterator) is used.
void frequencies() throws DatabaseException
{
SecondaryCursor cM= this.positionDB.openSecondaryCursor(null, null);
DatabaseEntry key=new DatabaseEntry();
DatabaseEntry value=new DatabaseEntry();
while(cM.getNext(key, value,LockMode.DEFAULT)==OperationStatus.SUCCESS)
{
Marker m= Marker.class.cast(this.markerTupleBinding.entryToObject(value));
HashMap<Character, Integer> allele2count= new HashMap<Character, Integer>();
int totalGenotyped=0;
int totalFailures=0;
System.out.print("rs"+m.rsId+" "+m.alleles+" "+m.pos.chromosome+" "+m.pos.position+" "+m.strand);
Cursor cI= this.individualDB.openCursor(null, null);
while(cI.getNext(key, value,LockMode.DEFAULT)==OperationStatus.SUCCESS)
{
Individual indi=Individual.class.cast(this.individualTupleBinding.entryToObject(value));
Genotype g= getGenotypeAt(m, indi);
if(g!=null)
{
totalGenotyped++;
for(int i=0;i< 2;++i)
{
char c= (i==0?g.a1:g.a2);
Integer count= allele2count.get(c);
if(count==null) count=0;
allele2count.put(c,count+1);
}
}
else
{
totalFailures++;
}
}
cI.close();
System.out.print(" genotyped:"+(int)(100.0*(totalGenotyped-totalFailures)/(float)totalGenotyped)+"%");
for(Character allele: allele2count.keySet())
{
System.out.print(" f("+allele+")="+allele2count.get(allele)/(2.0*totalGenotyped));
}
System.out.println();
}
cM.close();
}



Finding the Mendelian incompatibilities is much like the same: I sued here the brute force, we loop over each individual and over each marker. If the individual as any parent, we check that his genotype is compatible with them.
void incompats() throws DatabaseException
{
DatabaseEntry key=new DatabaseEntry();
DatabaseEntry value=new DatabaseEntry();

Cursor cI= this.individualDB.openCursor(null, null);
while(cI.getNext(key, value,LockMode.DEFAULT)==OperationStatus.SUCCESS)
{
Individual indi=Individual.class.cast(this.individualTupleBinding.entryToObject(value));

if(indi.fatherID==null && indi.motherID==null)
{
continue;
}

Individual father= findIndividualByCorrielId(indi.fatherID);
Individual mother= findIndividualByCorrielId(indi.motherID);

Cursor cM= this.markerDB.openCursor(null, null);
while(cM.getNext(key, value,LockMode.DEFAULT)==OperationStatus.SUCCESS)
{
Marker m= Marker.class.cast(this.markerTupleBinding.entryToObject(value));
Genotype gChild= getGenotypeAt(m, indi);
Genotype gFather= getGenotypeAt(m, father);
if(isIncompat(gChild,gFather))
{
System.out.println("Incompat: for rs"+m.getRSId()+"("+m.alleles+") "+
indi.individualID+" is "+gChild+" and his father "+indi.fatherID+" is "+
gFather
);
continue;
}
Genotype gMother= getGenotypeAt(m, mother);
if(isIncompat(gChild,gMother))
{
System.out.println("Incompat: for rs"+m.getRSId()+"("+m.alleles+") "+
indi.individualID+" is "+gChild+" and his mother "+indi.motherID+" is "+
gMother
);
continue;
}
if(isIncompat(gChild,gFather,gMother))
{
System.out.println("Incompat: for rs"+m.getRSId()+"("+m.alleles+") "+
indi.individualID+" is "+gChild+
" and his father "+indi.fatherID+" is "+ gFather+" and his mother "+indi.motherID+" is "+ gMother
);
}
}
cM.close();
}
cI.close();
}


That's it. I first test the chromosome 1 at http://www.hapmap.org/genotypes/latest/rs_strand/non-redundant/genotypes_chr1_CEU_r23a_nr.b36.txt.gz(11Mo) but I pressed Ctrl-C when the files reached 1.4Go !
I then used the chr22 file directly downloaded on my computer. The space required by BerkeleyDB to hold the database and the indexes was 721Mo whereas the zipped original source of data was 2Mo (25Mo unzipped)!!! (Arghhhhhhhhhhhh !!!!!).

  • Individuals count:=90

  • Markers count:=54786

  • Genotypes count:=4853237


Time required to load the hapmap file : 1174secs (20min)

rs9624968 A/G chr22 24783030 + genotyped:86% f(G)=0.879746835443038 f(A)=0.12025316455696203
rs9624969 C/T chr22 24784595 + genotyped:87% f(T)=0.075 f(C)=0.925
rs6004919 C/T chr22 24785216 + genotyped:100% f(T)=0.12777777777777777 f(C)=0.8722222222222222
rs4585127 A/G chr22 24785559 + genotyped:100% f(G)=0.8722222222222222 f(A)=0.12777777777777777
rs5752262 A/G chr22 24786367 + genotyped:95% f(G)=0.5116279069767442 f(A)=0.4883720930232558
rs16981296 C/G chr22 24787784 + genotyped:95% f(G)=0.8488372093023255 f(C)=0.1511627906976744
rs1003547 G/T chr22 24788134 + genotyped:86% f(T)=0.44936708860759494 f(G)=0.5506329113924051
rs9613094 A/G chr22 24788388 + genotyped:100% f(G)=0.2222222222222222 f(A)=0.7777777777777778
rs16986627 A/G chr22 24789298 + genotyped:88% f(G)=0.2654320987654321 f(A)=0.7345679012345679
(...)


Time required to generate the frequencies Time:955secs

Incompat: for rs133457(C/T) 1341M02 is CC and his father 1341MF13 is TT
Incompat: for rs136009(C/T) 1341M02 is CT and his father 1341MF13 is TT and his mother 1341MM14 is TT
Incompat: for rs394518(C/T) 1341M02 is CT and his father 1341MF13 is TT and his mother 1341MM14 is TT
Incompat: for rs628437(A/C) 1341M02 is AC and his father 1341MF13 is CC and his mother 1341MM14 is CC
Incompat: for rs731403(C/G) 1341M02 is GG and his mother 1341MM14 is CC
Incompat: for rs1122940(C/T) 1341M02 is CT and his father 1341MF13 is TT and his mother 1341MM14 is TT
Incompat: for rs2845343(A/T) 1341M02 is AA and his mother 1341MM14 is TT
Incompat: for rs4822498(C/T) 1341M02 is CC and his father 1341MF13 is TT
Incompat: for rs4822499(C/T) 1341M02 is TT and his father 1341MF13 is CC
Incompat: for rs4823195(A/G) 1341M02 is AA and his mother 1341MM14 is GG
Incompat: for rs4991267(C/T) 1341M02 is CC and his mother 1341MM14 is TT
Incompat: for rs5755047(A/T) 1341M02 is TT and his father 1341MF13 is AA
Incompat: for rs5755343(A/T) 1341M02 is AA and his mother 1341MM14 is TT
Incompat: for rs5755420(A/C) 1341M02 is AC and his father 1341MF13 is CC and his mother 1341MM14 is CC
Incompat: for rs5765056(C/T) 1341M02 is CT and his father 1341MF13 is CC and his mother 1341MM14 is CC
Incompat: for rs5765436(A/C) 1341M02 is AC and his father 1341MF13 is CC and his mother 1341MM14 is CC
Incompat: for rs5765499(C/T) 1341M02 is CC and his father 1341MF13 is TT
Incompat: for rs5768636(G/T) 1341M02 is GT and his father 1341MF13 is GG and his mother 1341MM14 is GG
Incompat: for rs5769710(C/T) 1341M02 is CC and his father 1341MF13 is TT
Incompat: for rs5770600(A/C) 1341M02 is CC and his father 1341MF13 is AA
Incompat: for rs5997220(A/G) 1341M02 is AG and his father 1341MF13 is GG and his mother 1341MM14 is GG
(...)
764 errors


Time required to find the Mendelian incompatibilities: 11021secs (~3H00)

When the program closed, the database was compacted down to 710Mo.

Conclusion: Too slow, some huges files generated. Definitely a bad choice to handle this kind of data.

03 April 2008

Study Collaborators Included in PubMed

Via NLM Technical Bulletin:

As of November 2007, there were over 57,000 occurrences of group (corporate) authors in MEDLINE/PubMed with over 17,000 citations with no co-occurring personal authors. Not everyone involved in a group is actually writing or authoring the paper, however. NLM agrees (...) that "Authorship credit should be based on

  1. substantial contributions to conception and design, or acquisition of data, or analysis and interpretation of data
  2. drafting the article or revising it critically for important intellectual content
  3. final approval of the version to be published
Taking these and other factors into consideration, NLM decided that it is time to include the individual names associated with the group authors in MEDLINE/PubMed. Therefore, when a group name is included as an author, the respective group member names appearing in the article will be acknowledged as collaborators but not associated with authorship. This significant enhancement allows PubMed users to identify articles to which an individual has contributed, whether as an author or as a collaborator. NLM has implemented this new feature routinely for MEDLINE citations created beginning in March 2008 if the article was published in 2008 forward.


See also: