WebServices/JAXWS for SNP, Glassfish, Taverna: my notebook
In this post I describe how to deploy a WebService in the GlassFish web server and to to use it via the Taverna workflow engine.
Server side
Classes
The JAX-WS API (the java API for Web Services) was used here. Our Web Service will be designed to
- find the position of the SNP from his name
- find the SNPs in a given region
implements Serializable
{
private static final long serialVersionUID = 1L;
private String name=null;
private String acn=null;
private String chromosome=null;
private String sequence=null;
private int position=-1;
(...)
//getters and setters here...
(...)
}
The interface of our web service "SnpTool" is then defined. The class is decorated with the JAX-WS annotations defining the methods of the web service and the name of the parameters:
import javax.jws.WebMethod;
import javax.jws.WebParam;
import javax.jws.WebResult;
import javax.jws.WebService;
import javax.jws.soap.SOAPBinding;
import javax.jws.soap.SOAPBinding.Style;
@WebService
@SOAPBinding(style=Style.DOCUMENT)
public interface SnpTool
{
@WebMethod
@WebResult(name="SnpDescriptorList")
public SNP[] getSNPByName(@WebParam(name="rsNumber")String name) throws Exception;
@WebMethod
@WebResult(name="SnpList")
public SNP[] getSNPByPosition(@WebParam(name="chromosome")String chrom,@WebParam(name="start")int start,@WebParam(name="end")int end) throws Exception;
}
@SOAPBinding(style=Style.DOCUMENT) was critical because Taverna doesn't seem to handle Style.RPC.The service for SnpTool is then implemented. As I want to configure this WebService on deployment time (for example to specify a maximum number of SNPs to be retrieved, the default assembly, etc...), we need to get a handle to the web container: this pointer was obtained by injecting a @WebServiceContext annotation. This context is then used to retrieve the initialization parameters of the web application. Warning, this context is not initialized in the SNPToolWeb constructor.
import java.io.File;
import javax.annotation.Resource;
import javax.jws.WebService;
import javax.servlet.ServletContext;
import javax.xml.ws.WebServiceContext;
import javax.xml.ws.handler.MessageContext;
import fr.cephb.joperon.core.bio.Assembly;
@WebService(endpointInterface="fr.cephb.operon.server.ws.SnpTool")
public class SNPToolWeb
implements SnpTool
{
@Resource
private WebServiceContext wsContext=null;
/** max number of SNP to be retrieved */
private Integer maxNumberOfSNP=null;
private Integer getMaxNumberOfSNP() throws Exception
{
if(maxNumberOfSNP!=null) return maxNumberOfSNP;
MessageContext ctxt = wsContext.getMessageContext();
ServletContext ctx = (ServletContext)ctxt.get(MessageContext.SERVLET_CONTEXT);
String s= ctx.getInitParameter("limit");
if(s!=null)
{
maxNumberOfSNP=Integer.parseInt(s);
}
return maxNumberOfSNP;
}
@Override
public SNP[] getSNPByName(String rsName) throws Exception {
//get your data here from a database, a file, etc....
//yes it returns an array because some SNP may have been merged
return snp;
}
@Override
public SNP[] getSNPByPosition(String krom, int start, int end)
throws Exception {
List<SNP> list= new ArrayList<SNP>();
//get your data here....
return list.toArray(new SNP[list.size()]);
}
}
Compile and Deploy
The developement descriptor looks like this:<context-param>
<param-name>limit</param-name>
<param-value>1000000</param-value>
</context-param>
</web-app>
Ant is called to deploy this web service in Glassfish. Note that wsgen was invoked to generate the JAX-WS portable artifacts used in JAX-WS web services.
<property environment="env"/>
<property name="home.dir" value="${env.HOME}"/>
<property name="rootdir" value="."/>
<property name="builddir" value="${rootdir}/build"/>
<property name="compiledir" value="${builddir}/compile"/>
<property file="${home.dir}/.project-properties"/>
<path id="libraries">
<pathelement path="lib1.jar"/>
<pathelement path="lib2.jar"/>
</path>
<path id="j2eelib">
<pathelement path="${appserver.dir}/lib/webservices-rt.jar"/>
<pathelement path="${appserver.dir}/lib/webservices-tools.jar"/>
</path>
<target name="demoservlet">
<mkdir dir="${compiledir}"/>
<mkdir dir="${builddir}"/>
<copy todir="${compiledir}" includeEmptyDirs="false">
<fileset dir="${rootdir}/src/java">
<filename name="**/*.java"/>
</fileset>
<fileset dir="${rootdir}/src/java">
<filename name="**/*.xml"/>
</fileset>
</copy>
<javac srcdir="${compiledir}" destdir="${compiledir}" debug="true" source="1.6" target="1.6">
<include name="**/SNPServlet.java"/>
<include name="**/SNPToolWeb.java"/>
<classpath>
<path refid="libraries"/>
<pathelement location="${appserver.dir}/lib/j2ee.jar"/>
</classpath>
</javac>
<echo message="Running wsgen"/>
<exec executable="${appserver.dir}/bin/wsgen">
<arg value="-cp"/> <arg value="${appserver.dir}/lib/j2ee.jar:$lib1.jar:$lib2.jar:${compiledir}"/>
<arg value="-verbose"/>
<arg value="-s"/> <arg value="${compiledir}"/>
<arg value="-d"/> <arg value="${compiledir}"/>
<arg value="-wsdl"/>
<arg value="-keep"/>
<arg value="fr.cephb.operon.server.ws.SNPToolWeb"/>
</exec>
<delete includeEmptyDirs="true">
<fileset dir="${compiledir}" includes="**/*.java"/>
</delete>
<war destfile="${builddir}/snp2rdf.war" webxml="${compiledir}/WEB-INF/web.xml">
<lib file="lib1.jar"/>
<classes dir="${compiledir}"/>
</war>
<delete dir="${compiledir}"/>
<exec executable="asadmin" failonerror="true">
<arg value="deploy"/>
<arg line="--user username"/>
<arg line="--passwordfile ${passwordfile}"/>
<arg value="--host"/>
<arg value="localhost"/>
<arg value="--port"/>
<arg value="${domain.admin.port}"/>
<arg value="--echo=true"/>
</>
<arg value="--libraries"/><arg value="lib1.jar"/>
<arg value="${builddir}/snp2rdf.war"/>
</exec>
</target>
</project>
The WSDL
After this WebService was compiled and deployed, we can see its WSDL athttp://www.example.org:8080/snp2rdf/SNPToolWebService?wsdl:<types>
<xsd:schema>
<xsd:import namespace="http://ws.server.operon.cephb.fr/" schemaLocation="http://www.example.org:8080/snp2rdf/SNPToolWebService?xsd=1"/>
</xsd:schema>
</types>
<message name="getSNPByName">
<part name="parameters" element="tns:getSNPByName"/>
</message>
<message name="getSNPByNameResponse">
<part name="parameters" element="tns:getSNPByNameResponse"/>
</message>
<message name="Exception">
<part name="fault" element="tns:Exception"/>
</message>
<message name="getAssemblyName">
<part name="parameters" element="tns:getAssemblyName"/>
</message>
<message name="getAssemblyNameResponse">
<part name="parameters" element="tns:getAssemblyNameResponse"/>
</message>
<message name="getSNPByPosition">
<part name="parameters" element="tns:getSNPByPosition"/>
</message>
<message name="getSNPByPositionResponse">
<part name="parameters" element="tns:getSNPByPositionResponse"/>
</message>
<portType name="SnpTool">
<operation name="getSNPByName">
<input message="tns:getSNPByName"/>
<output message="tns:getSNPByNameResponse"/>
<fault message="tns:Exception" name="Exception"/>
</operation>
<operation name="getAssemblyName">
<input message="tns:getAssemblyName"/>
<output message="tns:getAssemblyNameResponse"/>
<fault message="tns:Exception" name="Exception"/>
</operation>
<operation name="getSNPByPosition">
<input message="tns:getSNPByPosition"/>
<output message="tns:getSNPByPositionResponse"/>
<fault message="tns:Exception" name="Exception"/>
</operation>
</portType>
<binding name="SNPToolWebPortBinding" type="tns:SnpTool">
<soap:binding transport="http://schemas.xmlsoap.org/soap/http" style="document"/>
<operation name="getSNPByName">
<soap:operation soapAction=""/>
<input>
<soap:body use="literal"/>
</input>
<output>
<soap:body use="literal"/>
</output>
<fault name="Exception">
<soap:fault name="Exception" use="literal"/>
</fault>
</operation>
<operation name="getAssemblyName">
<soap:operation soapAction=""/>
<input>
<soap:body use="literal"/>
</input>
<output>
<soap:body use="literal"/>
</output>
<fault name="Exception">
<soap:fault name="Exception" use="literal"/>
</fault>
</operation>
<operation name="getSNPByPosition">
<soap:operation soapAction=""/>
<input>
<soap:body use="literal"/>
</input>
<output>
<soap:body use="literal"/>
</output>
<fault name="Exception">
<soap:fault name="Exception" use="literal"/>
</fault>
</operation>
</binding>
<service name="SNPToolWebService">
<port name="SNPToolWebPort" binding="tns:SNPToolWebPortBinding">
<soap:address location="http://www.example.org:8080/snp2rdf/SNPToolWebService"/>
</port>
</service>
</definitions>
Client side
Creating a Client with wsimport
I've previously described how to use wsimport to generate the classes using a WebService in a previous post (see "The EBI/IntAct Web-Service API, my notebook")
Using the WS with Taverna
I've used this WSDL to run my first Taverna workflow: the input is the SNP "rs25". The Web Services invoked finds its position on the human genome and find its neighbours at 100bp. The XML result is then saved to a local file.
- The green nodes are the WebServices.
- The blue nodes are the constants (e.g. "rs25")
- The orange node is a simple Java BeanShell script extending the position of the SNP: left=Math.max(0,Integer.parseInt(position)-Integer.parseInt(extend));
right=Integer.parseInt(position)+Integer.parseInt(extend); - the purple nodes are the XML scavengers (a mysterious thing used to convert a structure to/from a XML file) and the processors (e.g. write to a file)
We this workflow was invoked it saved the following file:
<SnpList>
<acn>rs12699208</acn>
<chromosome>Chr7</chromosome>
<name>rs12699208</name>
<position>11549694</position>
<sequence>(...)TATAGCTTCAACATATATGAAAAAAATGTCCACTGA[R]TAGTTCCTGGTGGAGAACTCTCCCATCTCTTTTG</sequence>
</SnpList>
<SnpList>
<acn>rs27</acn>
<chromosome>Chr7</chromosome>
<name>rs27</name>
<position>11549750</position>
<sequence>(..)CCCCCATTTGAGATCCTTCTTCATCTCACCTG[S]TACCTCTCAATCCCGGTGAACCAAAAGAGATGGG(...)</sequence>
</SnpList>
(...)
<SnpList>
<acn>rs7458209</acn>
<chromosome>Chr7</chromosome>
<name>rs7458209</name>
<position>11551560</position>
<sequence>(...)GAAAACTTTAGGAAGCAAACAT[Y]GTTTTATTAAGAAAACAGGTTAAGCAAGATGGCTGACAGGAAGAGCTTCTCC(...)</sequence>
</SnpList>
</ns2:getSNPByPositionResponse>
. Please note that this web service is under developpement and might be replaced and/or switched off soon.
That's it !
Pierre