Zoom.it is a free service for viewing and sharing high-resolution imagery. You give us the link to any image ( including SVG, pdfs) on the web along with a nice short URL.. As a test, I used the SVG file "Tree of life with genome size.svg" on wikipedia and here is the awesome result generated by Zoom.it:
I've just started creating a wikipedia infobox to annotate the biological databases in wikipedia. If many articles use this template, then it will be possible to parse the them and to create a list of the databases providing some web services, some SPARQL endpoints, having a download area etc...
The infobox itself is still a draft, so feel free to modify it or to suggest some other fields in the 'Talk' page.
Apache CXF is a Web Services framework. In this post, I'll will describe how I implemented a Web Service translating a DNA to a protein using the web server Apache Tomcat and the CXF libraries.
./translate/WEB-INF/classes/bio/TranslateImpl.javaThe service was compiled and deployed using the following Makefile:
./translate/WEB-INF/classes/bio/Translate.java
./translate/WEB-INF/beans.xml
./translate/WEB-INF/web.xml
Translate
| Endpoint address: http://localhost:8080/translate/translateMit WSDL : {http://bio/}TranslateService Target namespace: http://bio/ |
Translate
| Endpoint address: http://localhost:8080/translate/translateStd WSDL : {http://bio/}TranslateService Target namespace: http://bio/ |
I recently asked on Biostar if it would be worth to mask the non-genic sequence before aligning the short reads on the reference after an exome sequencing. Although I was convinced by the answer of lh3, I was curious to observe the difference with some real data.
I've downloaded two fastqs files from ftp://ftp-trace.ncbi.nih.gov/1000genomes/ftp/pilot_data/data/NA20772/sequence_read/ERR004053_*.recal.fastq.gz and the sequence for the human chromosome chr1 from the UCSC.
One copy of chr1.fa was masked using the UCSC knownGene table +/- 10kb using a custom software. The bases were replaced by a 'N' if they were not contained in a genic region+/-10kb.
100005921 100005931 100005941 100005951 100005961 100005971
tgctaattggtcagattggagatggaatca*tggggggtcgacgtgaggttttcttgctgtcttct
....G.........G............... MM.......R.A....RK.................
.. ,,,,,,,,,,,,,,cac,,,,,,,,,a,,,,a,,, ,,,,,,,,,,,,,
.... ..........*CA.......A.A.......N....... ,,,,,,
.. ..........*CA.......A.A............... ,,,,
G...G..G.. ..........*CA.......A.A...............
....G.........G..T.. ...........T.................
....G....... .....A.....T.................
,,,,g,,,,,,,,,g,,,,,,,,,,,,,,,*,,,,, ..............G........
100005931 100005941 100005951 100005961 100005971 100005981in this case, it is visiblethat the reads have been more correctly aligned on the non-masked sequence.
tcagattggagatggaatcatggggggtcgacgtgaggttttcttgctgtcttctgttcctgggtg
..........CA.......R.A.....K............................
..........CA.......A.A.......N.......
...........T.........................
.....A.....T.........................
.A..................................
..............G...................
The Variant Call Format is a text file format generated by many tools for NGS. It contains meta-information lines, a header line, and then data lines describing how the mutations were called. I don't like this format because it cannot be used to store some hierachical annotations (like json or xml), nevertheless it is a de facto standard.
I wrote a tool called vcfannotator to append a set of annotations from the UCSC database to a VCF file. As I wanted to keep this tool simple and without any dependencies, it only uses the flat files available from the download area at the UCSC.
This tools appends several informations:
jsandbox/src/sandbox/VCFAnnotator.java.
