Notes about bwa 0.6.2 and the multiple hits.
Here are my notes about the way bwa 0.6.2 handles the multiple hits.
I've created a sub-sequence (~6Mb ) of the human chr22 (see the Makefile below). The sequence doesn't contain any base 'N' or any lowercase (=repeatMasked) letter.
1E6 reads (forward and reverse) have been generated from this ~chr22 with samtools wgsim. No mutation and no sequencing error have been allowed.
This ~chr22 sequence have been duplicated and renamed as 'DUP'. Both sequences have been merged in one fasta file named 'twoChrom.fa'
The reads have been aligned with BWA (v. 0.6.2-r126) on this genome.
There's only one SAM alignment per read
$ samtools view align.sorted.bam | wc -l 2000000
1% of the reads were not properly paired/mapped on the genome
$ samtools view -f 2 align.sorted.bam | wc -l 1999926
The properly mapped reads contain some informations about the alternative hits in 'XA'
$samtools view -f 2 align.sorted.bam | grep 22_10_402_0 | verticalize -n >>> 1 $1 22_10_402_0:0:0_0:0:0_c1608 $2 99 $3 22 $4 10 $5 0 $6 70M $7 = $8 333 $9 393 $10 GGGACGGTCATGCAATCTGGACAACATTCACCTTTAAAAGTTTATTGATCTTTTGTGACATGCACGTGGG $11 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII $12 XT:A:R $13 NM:i:0 $14 SM:i:0 $15 AM:i:0 $16 X0:i:2 $17 X1:i:0 $18 XM:i:0 $19 XO:i:0 $20 XG:i:0 $21 MD:Z:70 $22 XA:Z:DUP,+10,70M,0; <<< 1 >>> 2 $1 22_10_402_0:0:0_0:0:0_c1608 $2 147 $3 22 $4 333 $5 0 $6 70M $7 = $8 10 $9 -393 $10 ATACCTGCCAGATGAGTCACTGGCAAAAGGTGCTGCTCCCTGGTGAGGGAGAAACACCAGGGGCTGGGAG $11 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII $12 XT:A:R $13 NM:i:0 $14 SM:i:0 $15 AM:i:0 $16 X0:i:2 $17 X1:i:0 $18 XM:i:0 $19 XO:i:0 $20 XG:i:0 $21 MD:Z:70 $22 XA:Z:DUP,-333,70M,0; <<< 2
50% mapped on chr22, 50% mapped on DUP
$ samtools view -f 2 align.sorted.bam | cut -d ' ' -f 3 | sort | uniq -c 999860 22 1000066 DUP
Some pairs have been unmapped because the mate have been mapped on the other chromosome !
$ samtools-0.1.18/samtools view -F 2 align.sorted.bam | grep 22_1210321_1210924 | verticalize -n >>> 1 $1 22_1210321_1210924_0:0:0_0:0:0_e28f5 $2 81 $3 22 $4 1210855 $5 0 $6 70M $7 DUP $8 1210321 $9 0 $10 AGAGACTGAGTCCGGCTAGAGAACAGGGTGGAGCCCCTTTGGACCTTAGAGCTGGGCCTTTGGGCCTTGG $11 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII $12 XT:A:R $13 NM:i:0 $14 SM:i:0 $15 AM:i:0 $16 X0:i:6 $17 X1:i:0 $18 XM:i:0 $19 XO:i:0 $20 XG:i:0 $21 MD:Z:70 $22 XA:Z:22,-1996342,70M,0;DUP,-1996342,70M,0;22,+2551778,70M,0;DUP,+2551778,70M,0;DUP,-1210855,70M,0; <<< 1 >>> 2 $1 22_1210321_1210924_0:0:0_0:0:0_e28f5 $2 161 $3 DUP $4 1210321 $5 0 $6 70M $7 22 $8 1210855 $9 0 $10 CCCGGGCCGGATGGCTCGCCTGCGCGGCCAGCTCCGGGCCGAAGCGGCTTCGCGGTCCGAGGTGCCGCGG $11 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII $12 XT:A:R $13 NM:i:0 $14 SM:i:0 $15 AM:i:0 $16 X0:i:2 $17 X1:i:0 $18 XM:i:0 $19 XO:i:0 $20 XG:i:0 $21 MD:Z:70 $22 XA:Z:22,+1210321,70M,0; <<< 2
The Makefile
SAMDIR=/usr/local/package/samtools-0.1.18
SAMTOOLS=$(SAMDIR)/samtools
BCFTOOLS=$(SAMDIR)/bcftools/bcftools
BWA=/usr/local/package/bwa-0.6.2/bwa
REF1=chr22.fa
REF2=twoChrom.fa
.INTERMEDIATE : align.sam random_1.sai random_2.sai align.bam variations.bcf
%.bam : %.sam
$(SAMTOOLS) view -o $@ -b -S -T $(REF2) $<
%.bam.bai : %.bam
$(SAMTOOLS) index $<
align.sorted.bam : align.bam
$(SAMTOOLS) sort $< align.sorted
align.sam : random_1.sai random_2.sai
$(BWA) sampe -a 600 $(REF2) $^ random_1.fq.gz random_2.fq.gz > $@
$(REF1):
curl -s "http://hgdownload.cse.ucsc.edu/goldenPath/hg19/chromosomes/$(REF1).gz" |\
gunzip -c | sed 's/^>chr/>/' | grep -v '[Nnatgc]' | head -n 100000 > $@
random_1.sai : random_1.fq.gz $(REF2).bwt
$(BWA) aln -f $@ $(REF2) $<
random_2.sai : random_2.fq.gz $(REF2).bwt
$(BWA) aln -f $@ $(REF2) $<
random_1.fq.gz random_2.fq.gz : $(REF1)
$(SAMDIR)/misc/wgsim -N 1000000 -e 0.0 -r 0.0 -d 400 $< random_1.fq random_2.fq > wgsim.output
gzip -f --best random_1.fq random_2.fq
$(REF2): $(REF1)
cp $< $@
sed 's/^>.*/>DUP/' $< >> $@
$(REF2).bwt : $(REF2)
$(BWA) index -a bwtsw $<
$(REF2).fai : $(REF2)
$(SAMTOOLS) faidx $<
clean:
rm -f chr22.* *.bam *.vcf *.bcf *.sai *.gz *.fq *.bai wgsim.output *.sam
That's it,Pierre

No comments:
Post a Comment