bye ! bye ! my private web server !

I'm about to leave my current job. Thus, soon or later, the web server where I stored my stuff will diseappear. Most of those items have been introduced on this blog.

• Pubmed2connotea: A Greasemonkey user script which alters the content web page when browsing your bibliography on NCBI pubmed by inserting a new hyperlink "Add to Connotea/citeulike/delicious". I've transfered the script on http://userscripts.org/scripts/show/29415
• Java sandbox: some tests with Derby, Stax, Jaxb, scriptEngine
• Mysql UDF Mysql user defined functions. e.g. select translate("ATAGCTAGCATGGCTAGCAGCAGCTGCTTGCTAGCA")
• old google coop xml based on connotea
• connoteasvg: A GreaseMonkey Script displaying TreeMaps of Tags in Connotea
• Connotea Explorer 2. Explore connotea using treemaps,AJAX,SVG,XSLT,javascript.
• Annoconnotea:is a java servlet acting as a link between Connotea and Annozilla allowing scientist to see and share comments about a web site/ a paper. It can also be used to send a new bookmark to Connotea.
• UCSC Genome Browser with SVG
• xul4wikipedia: creates a firefox extension for inserting custom text in wikipedia
• Custom Search Tools for Science
• History of Sciences from freebase data
• IBD Status Applet: get IBD status from CEPH data
• My Biological Network: creating a biological network using google gears
• Translating DNA to protein using the Google Web Toolkit
• Exploring the 'Nature Network' : SVG, XML, javascript & json
• Presentation about web2.0 and Science using slidy
• WikiStory: Applet. History of Sciences based on DBPedia
• A Google Gadget for Bioinformatics
• SciFOAF: create your FOAF profile from pubmed (old)
• MyFOAFExplorer: java applet browsing a FOAF network
• Connotea Explorer: old java application browsing connotea using treemaps
• Search engine for connotea/firefox
• SVG TreeMap with PHP
• My Thesis (2000)

Pierre