- Pubmed2connotea: A Greasemonkey user script which alters the content web page when browsing your bibliography on NCBI pubmed by inserting a new hyperlink "Add to Connotea/citeulike/delicious". I've transfered the script on http://userscripts.org/scripts/show/29415
- Java sandbox: some tests with Derby, Stax, Jaxb, scriptEngine
- Mysql UDF Mysql user defined functions. e.g.
select translate("ATAGCTAGCATGGCTAGCAGCAGCTGCTTGCTAGCA")
- old google coop xml based on connotea
- connoteasvg: A GreaseMonkey Script displaying TreeMaps of Tags in Connotea
- Connotea Explorer 2. Explore connotea using treemaps,AJAX,SVG,XSLT,javascript.
- Annoconnotea:is a java servlet acting as a link between Connotea and Annozilla allowing scientist to see and share comments about a web site/ a paper. It can also be used to send a new bookmark to Connotea.
- UCSC Genome Browser with SVG
- xul4wikipedia: creates a firefox extension for inserting custom text in wikipedia
- Custom Search Tools for Science
- History of Sciences from freebase data
- IBD Status Applet: get IBD status from CEPH data
- My Biological Network: creating a biological network using google gears
- Translating DNA to protein using the Google Web Toolkit
- Exploring the 'Nature Network' : SVG, XML, javascript & json
- Presentation about web2.0 and Science using slidy
- WikiStory: Applet. History of Sciences based on DBPedia
- A Google Gadget for Bioinformatics
- SciFOAF: create your FOAF profile from pubmed (old)
- MyFOAFExplorer: java applet browsing a FOAF network
- Connotea Explorer: old java application browsing connotea using treemaps
- Search engine for connotea/firefox
- SVG TreeMap with PHP
- My Thesis (2000)
Pierre
Good luck with the new job Pierre! (I assume there's a new job?!) ;)
ReplyDeleteAt this time, I'm still investigating... :-)
ReplyDeleteIt doesn't cost much to get your own server:
ReplyDeletehttp://www.ovh.com/fr/particulier/produits/kimsufi08.xml
You can leave your jobs anytime you feel then ...
Your anonymous former boss (from a year ago) ;-)