Searching for Genotypes with SPARQL.

This week-end, I've noticed that the NCBI has an interface called Genotype Query Form used to query some genotypes the generating the following kind of XML output:

<GenoExchange xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns="http://www.ncbi.nlm
.nih.gov/SNP/geno" xsi:schemaLocation="http://www.ncbi.nlm.nih.gov/SNP/geno ftp://ftp.ncbi.nlm.nih.gov/snp/specs/genoex_1_4.xsd" dbSNPBuildNo="129">
<Population popId="1409" handle="CSHL-HAPMAP" locPopId="HapMap-CEU">
<popClass self="NOT SPECIFIED" />
</Population>
<Individual indId="170" taxId="9606" sex="F" indGroup="European">
<SourceInfo source="Coriell" sourceType="repository" ncbiPedId="80" pedId="1340" indId="NA07000" maId="0" paId="0" srcIndGroup="Western and Nothern European" />
<SubmitInfo popId="1409" submittedIndId="NA07000" subIndGroup="Western and Northern European" />
</Individual>
<Individual indId="621" taxId="9606" sex="F" indGroup="European">

(...)
<SnpLoc genomicAssembly="36:reference" chrom="1" start="1286927" locType="2" rsOrientToCh
rom="rev" contigAllele="C" />
<SsInfo ssId="3906671" locSnpId="AL139287.6_22772" ssOrientToRs="fwd">
<ByPop popId="1409" sampleSize="120">
<AlleleFreq allele="A" freq="0.117" />
<AlleleFreq allele="G" freq="0.883" />
<GTypeFreq gtype="A/G" freq="0.233" />
<GTypeFreq gtype="G/G" freq="0.767" />
(...)
<GTypeByInd indId="636" gtype="G/G" />
<GTypeByInd indId="456" gtype="G/G" />
<GTypeByInd indId="536" gtype="G/G" />
</ByPop>
</SsInfo>
<GTypeFreq gtype="A/A" freq="0.380952380952381" />
<GTypeFreq gtype="A/G" freq="0.352380952380952" />
<GTypeFreq gtype="G/G" freq="0.266666666666667" />
</SnpInfo>
<SnpInfo rsId="2765021" observed="A/G">
(...)

I wanted to see how one could query this kind of data with SPARQL... well, I'm sure that RDF is one of the most inefficient way to store this kind of data but I wanted to see what could be extracted from such RDFStore from a semantic query. First, I wrote a XSLT stylesheet transforming <GenoExchange/> to <rdf:RDF/>. The stylsheet is available at http://code.google.com/p/lindenb/source/browse/trunk/src/xsl/genoexch2rdf.xsl.
.

Transform the data

About 639 HAPMAP snps on the chromosome 1 were extracted using the HTML form and saved as XML to the file 'SNPgenotype-100201-1244-3905.xml'(size 4Mo). The xml was converted to RDF with the xsltproc engine:

xsltproc --stringparam "with-sequence" yes --novalid genoexch2rdf.xsl SNPgenotype-100201-1244-3905.xml > input.rdf

The size of 'input.rdf' (including the flanking sequences of the SNPs) was 20Mo.

Result

<?xml version="1.0"?>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:g="http://www.ncbi.nlm.nih.gov/SNP/geno" xmlns:snp="http://www.ncbi.nlm.nih.gov/SNP/docsum" xmlns="http://ontology.lindenb.org/genotypes/">
<Population rdf:about="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&amp;pop_id=1409">
<handle>CSHL-HAPMAP</handle>
<locPopId>HapMap-CEU</locPopId>
</Population>
<Individual rdf:about="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=170">
<hasPop rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&amp;pop_id=1409"/>
<sex>F</sex>
<name>NA07000</name>
</Individual>
<Individual rdf:about="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=621">
<hasPop rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&amp;pop_id=1409"/>
<sex>F</sex>
<name>NA12875</name>
</Individual>
<Individual rdf:about="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=538">
<hasPop rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&amp;pop_id=1409"/>
<sex>F</sex>
<name>NA12753</name>
(...)
<SNP rdf:about="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=307347">
<het rdf:datatype="http://www.w3.org/2001/XMLSchema#float">0.1</het>
<name>rs307347</name>
<seq5>GGGGATGGCTGCTCCTGGGCCTCAGAAAGATGCAGTCCCATAGACTTCCAGCACGCCCCTCCCCTCCTCGGGCCTTAATTTTGTCCACTGAGAAGATGGTCTCTGAGGCTCTGGGGTTTCCTTCTTGGTCACCAGATATTCTGCGGGCCTTGCCTTCCTGCCCAGATTCGAGCCAGTGGCAAACAGAAGCTGCCAGGAGC</seq5>
<observed>C/T</observed>
<seq3>TCTCAGAGCTGTGGCTGGTGGCTCGGTAACAACAGGAAGGGCAGTGGCTGTGCAGGAGGCAGGCAGCTTGCCAGCCCAGGAAGGTGACCCAGGACACCTCCAGGCCTTTCCCAGGGCAGCCCAACGGCCCAAGGTCAGGGCCGGGCGCGAGGGCGGCCTGAGCACAGAGCACGGGGGCTGACAGCAGGCTGGGGGGCCAG</seq3>
</SNP>
<MapLoc>
<hasSNP rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=307347"/>
<strand>+</strand>
<chrom>1</chrom>
<start rdf:datatype="http://www.w3.org/2001/XMLSchema#integer">1320381</start>
<assembly rdf:resource="urn:assembly:Celera:36_3"/>
<type>exact</type>
</MapLoc>
(...)
<Genotype>
<hasIndi rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=465"/>
<hasSNP rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=940550"/>
<allele1>T</allele1>
<allele2>T</allele2>
</Genotype>
<Genotype>
<hasIndi rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=253"/>
<hasSNP rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=940550"/>
<allele1>T</allele1>
<allele2>T</allele2>
</Genotype>
</rdf:RDF>

Invoking ARQ

export ARQROOT=ARQ-2.5.0
ARQ-2.5.0/bin/arq --data ~/input.rdf --query ~/query01.rq

Dump All

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
SELECT ?s ?p ?o {?s ?p ?o.}

Result

| _:b0 | g:allele2 | "C" |
| _:b0 | g:allele1 | "C" |
| _:b0 | g:hasSNP | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17160669> |
| _:b0 | g:hasIndi | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=636> |
| _:b0 | rdf:type | g:Genotype |
| _:b1 | g:allele2 | "T" |
| _:b1 | g:allele1 | "C" |
| _:b1 | g:hasSNP | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17160669> |
| _:b1 | g:hasIndi | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=361> |
| _:b1 | rdf:type | g:Genotype |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=174> | g:name | "NA07048" |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=174> | g:sex | "M" |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=174> | g:hasPop | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&pop_id=1409> |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=174> | rdf:type | g:Individual |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=566> | g:name | "NA12802" |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=566> | g:sex | "F" |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=566> | g:hasPop | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&pop_id=1409> |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=566> | rdf:type | g:Individual |
| _:b2 | g:allele2 | "A" |
| _:b2 | g:allele1 | "A" |
| _:b2 | g:hasSNP | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=2765021> |
| _:b2 | g:hasIndi | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=429> |
| _:b2 | rdf:type | g:Genotype |
| _:b3 | g:allele2 | "C" |
| _:b3 | g:allele1 | "C" |
| _:b3 | g:hasSNP | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17160669> |
| _:b3 | g:hasIndi | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=546> |
| _:b3 | rdf:type | g:Genotype |
| _:b4 | g:allele2 | "T" |
| _:b4 | g:allele1 | "C" |
| _:b4 | g:hasSNP | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17160669> |
| _:b4 | g:hasIndi | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=159> |
| _:b4 | rdf:type | g:Genotype |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=621> | g:name | "NA12875" |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=621> | g:sex | "F" |
(...)

Select the populations

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
SELECT ?pop
{
?s a g:Population .
?s g:handle ?pop .
}

Result

-----------------
| pop |
=================
| "CSHL-HAPMAP" |
-----------------

List six individuals for each population

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
SELECT ?pop ?indi_name ?good
{
?s a g:Population .
?s g:handle ?pop .
?s2 a g:Individual .
?s2 g:hasPop ?s .
?s2 g:sex ?good .
?s2 g:name ?indi_name
}
limit 6

Result

------------------------------------
| pop | indi_name | good |
====================================
| "CSHL-HAPMAP" | "NA10854" | "F" |
| "CSHL-HAPMAP" | "NA12264" | "M" |
| "CSHL-HAPMAP" | "NA11993" | "F" |
| "CSHL-HAPMAP" | "NA10830" | "M" |
| "CSHL-HAPMAP" | "NA12762" | "M" |
| "CSHL-HAPMAP" | "NA12155" | "M" |
------------------------------------

List the SNPs having a flanking sequence containing 'CACACA'

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
PREFIX fn: <http://www.w3.org/2005/xpath-functions#>

SELECT ?name ?seq5 ?observed ?seq3
WHERE
{
?s a g:SNP .
?s g:name ?name .
?s g:seq5 ?seq5 .
?s g:seq3 ?seq3 .
?s g:observed ?observed .

FILTER (
fn:contains(fn:upper-case(?seq5), "CACACA") ||
fn:contains(fn:upper-case(?seq3), "CACACA")
)
}

Result

-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
| name | seq5 | observed | seq3 |
=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
| "rs17160669" | "GCCACCGCGCCTGGCCCACAAGCATAACTTTTATAAAAATAATTTACTTTTACAATTAAGCTTAGGAATCACACAGACTCAGGGCTGGCTCATGGCTTCC" | "C/T" | "GGCAAGTTAAACTCTGTACTTAGGCTCGGCGCGTATGAAATGGCTAATTCTAATCAGTGGTGCAATGAAGTAACTCCTCTAAAGAACTTATCGGGCCGGG" |
| "rs2765023" | "ACTTGTAAATTTAGTCAGCATACATAACTAACCAAAACTTCAATATATCTTGAGACCCCCTTGGGGGGCTGTCTCCATAAAAGTGACTTTCCCAGGAGAGTGACTGGATGTGATTGGCCAACACCGTCTTAGCCCGCAGGGGTTCCTGGCGCGGAAGCCTCACGTCCCTCCCCACAGCGAGTTTTCAGAATCCAAAGGCCGTAGGAGAAAGAAGGCTGGCGGTGTTTCCTCTTAGAGGGGAGAAACTCAGCCTGGGTAGGAGACCCAGCCCCACGCAGGGAAAACTGTGCTAACGCTTCC" | "A/G" | "ATGTGCGTGGCAGGTGCGGCGGCGGCGAATACGGTTTGTCCTCGAGCCTAACCCTGTCTGTGTTGGTGTCAGCAGTGGCCCCCCTACCACACACACAGGGTCCCTGGCGTCCCAAGACCACTCCTGGCAGCCCCGCCACTGGCTGCGCCTGGAAGCCGCGTCCTCAGGCCTCGCCTGGCATTTGCTGTCACAGAGGTTGCTTCCTTGGGTCCGTCCGTCCTCGCCCCTCCAGCCTGGGCGCCCCCCCACCCCTGTCTCATTCCCTCCACCACATGCAGCACAGTCCAGGAGGCTGGGGTC" |
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Get 12 Heterozygous Genotypes

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
PREFIX fn: <http://www.w3.org/2005/xpath-functions#>

SELECT ?indi ?snp ?a1 ?a2
WHERE
{
?s a g:Genotype .
?s g:allele1 ?a1 .
?s g:allele2 ?a2 .
?s g:hasIndi ?s2 .
?s2 g:name ?indi .
?s g:hasSNP ?s3 .
?s3 g:name ?snp .
FILTER ( ?a1 != ?a2 )
}
LIMIT 10

Result

----------------------------------------
| indi | snp | a1 | a2 |
========================================
| "NA12056" | "rs17160669" | "C" | "T" |
| "NA12716" | "rs17160669" | "C" | "T" |
| "NA12761" | "rs17160669" | "C" | "T" |
| "NA10839" | "rs2765023" | "A" | "G" |
| "NA12813" | "rs2765023" | "A" | "G" |
| "NA12760" | "rs2765023" | "A" | "G" |
| "NA12865" | "rs17160669" | "C" | "T" |
| "NA07056" | "rs17160669" | "C" | "T" |
| "NA12146" | "rs2765023" | "A" | "G" |
| "NA10860" | "rs2765023" | "A" | "G" |
| "NA10839" | "rs17160669" | "C" | "T" |
| "NA12812" | "rs17160669" | "C" | "T" |
----------------------------------------

List 12 SNPs on chr1 between 100000 and 500000 on the reference assembly, order by chrom/position

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
PREFIX fn: <http://www.w3.org/2005/xpath-functions#>

SELECT ?snp ?chrom ?orient ?start
WHERE
{
?s a g:SNP .
?s g:name ?snp .
?s2 a g:MapLoc .
?s2 g:hasSNP ?s .
?s2 g:chrom ?chrom .
?s2 g:chrom "1" .
?s2 g:strand ?orient .
?s2 g:start ?start .
?s2 g:assembly <urn:assembly:reference:36_3> .
FILTER ( ?start > 100000 && ?start< 500000)
}
ORDER BY ?chrom ?start
LIMIT 12

Result

------------------------------------------
| snp | chrom | orient | start |
==========================================
| "rs17009015" | "1" | "-" | 121810 |
| "rs11490937" | "1" | "+" | 222076 |
| "rs12041624" | "1" | "+" | 232164 |
| "rs11514575" | "1" | "-" | 235726 |
| "rs4731490" | "1" | "+" | 311783 |
| "rs4006867" | "1" | "+" | 325493 |
| "rs7462951" | "1" | "-" | 360984 |
| "rs4030300" | "1" | "+" | 392471 |
| "rs4030303" | "1" | "+" | 392552 |
| "rs9661032" | "1" | "-" | 396549 |
| "rs3872250" | "1" | "-" | 400742 |
| "rs3907361" | "1" | "-" | 412985 |
------------------------------------------

List the positions of 10 SNPs on the reference assembly and chr1, print the heterozygosity if it exists and is greater than 0.1

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>

SELECT ?snp ?chrom ?orient ?start ?het
WHERE
{
?s a g:SNP .
?s g:name ?snp .
?s2 a g:MapLoc .
?s2 g:hasSNP ?s .
?s2 g:chrom ?chrom .
?s2 g:chrom "1" .
?s2 g:strand ?orient .
?s2 g:start ?start .
?s2 g:assembly <urn:assembly:reference:36_3> .
OPTIONAL { ?s g:het ?het . FILTER ( ?het > 0.1 ) }
}
LIMIT 10

Result

------------------------------------------------------------------------------------------------
| snp | chrom | orient | start | het |
================================================================================================
| "rs7417504" | "1" | "+" | 555799 | |
| "rs10018120" | "1" | "-" | 241387750 | "0.48"^^<http://www.w3.org/2001/XMLSchema#float> |
| "rs12043546" | "1" | "+" | 224043895 | |
| "rs4023296" | "1" | "-" | 141776514 | |
| "rs1320571" | "1" | "+" | 1110293 | "0.31"^^<http://www.w3.org/2001/XMLSchema#float> |
| "rs1359759" | "1" | "+" | 115826181 | "0.49"^^<http://www.w3.org/2001/XMLSchema#float> |
| "rs7553429" | "1" | "+" | 1080419 | "0.19"^^<http://www.w3.org/2001/XMLSchema#float> |
| "rs4245756" | "1" | "+" | 789325 | |
| "rs3766177" | "1" | "-" | 1471210 | "0.5"^^<http://www.w3.org/2001/XMLSchema#float> |
| "rs9442372" | "1" | "+" | 1008566 | "0.46"^^<http://www.w3.org/2001/XMLSchema#float> |
------------------------------------------------------------------------------------------------

Print 10 differences between the Reference Assembly and the Celera Assembly

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>

SELECT ?snp ?chrom1 ?orient1 ?start1 ?chrom2 ?orient2 ?start2
WHERE
{
?s a g:SNP .
?s g:name ?snp .

?s2 a g:MapLoc .
?s2 g:hasSNP ?s .
?s2 g:chrom ?chrom1 .
?s2 g:strand ?orient1 .
?s2 g:start ?start1 .
?s2 g:assembly <urn:assembly:Celera:36_3> .

?s3 a g:MapLoc .
?s3 g:hasSNP ?s .
?s3 g:chrom ?chrom2 .
?s3 g:strand ?orient2 .
?s3 g:start ?start2 .
?s3 g:assembly <urn:assembly:reference:36_3> . .

}
LIMIT 10

Result

-----------------------------------------------------------------------------
| snp | chrom1 | orient1 | start1 | chrom2 | orient2 | start2 |
=============================================================================
| "rs7553640" | "1" | "-" | 833104 | "1" | "+" | 1751873 |
| "rs3951936" | "9" | "-" | 41330304 | "4" | "+" | 49186295 |
| "rs3951936" | "9" | "-" | 41330304 | "1" | "-" | 142233119 |
| "rs3951936" | "9" | "-" | 41330304 | "1" | "+" | 142038296 |
| "rs3951936" | "9" | "-" | 41330304 | "1" | "-" | 141781399 |
| "rs3951936" | "9" | "-" | 41330304 | "1" | "+" | 141641811 |
| "rs41319344" | "Y" | "+" | 10690990 | "Y" | "-" | 25853159 |
| "rs41319344" | "Y" | "+" | 10690990 | "Y" | "+" | 24928047 |
| "rs41319344" | "Y" | "+" | 10690990 | "1" | "-" | 241194834 |
| "rs10907183" | "1" | "-" | 1511375 | "1" | "+" | 1060980 |
-----------------------------------------------------------------------------

Create a new RDF graph of 10 SNPs having a neighbour at a distance less than 500pb

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
PREFIX fn: <http://www.w3.org/2005/xpath-functions#>

CONSTRUCT { ?snp1 g:hasNeighbour ?snp2 . }
WHERE
{
?snp1 a g:SNP .
?snp2 a g:SNP .

?s1 a g:MapLoc .
?s1 g:hasSNP ?snp1 .
?s1 g:chrom ?chrom1 .
?s1 g:strand ?orient1 .
?s1 g:start ?start1 .
?s1 g:assembly <urn:assembly:reference:36_3> .

?s2 a g:MapLoc .
?s2 g:hasSNP ?snp2 .
?s2 g:chrom ?chrom2 .
?s2 g:strand ?orient2 .
?s2 g:start ?start2 .
?s2 g:assembly <urn:assembly:reference:36_3> .

FILTER( (fn:abs(?start1 - ?start2) < 500) && ?chrom1=?chrom2 && ?snp1!=?snp2)

}
LIMIT 10

Result

@prefix : <http://ontology.lindenb.org/genotypes/> .
@prefix g: <http://ontology.lindenb.org/genotypes/> .
@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
@prefix fn: <http://www.w3.org/2005/xpath-functions#> .

<http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=7545812>
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=9970455> .

<http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=1043506>
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=12126411> .

<http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=6603793>
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=7548693> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=7553066> .

<http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=10907178>
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=10907177> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=11260588> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=11260587> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=6701114> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=3737728> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=9442398> .

That's it !
Pierre

CouchDB for Bioinformatics: Storing SNPs - My Notebook

In a previous post, I've been playing with Apache Hadoop.
I've encountered some technical difficulties with Hadoop (such as the simple question: "How should can I read my data from a file stored on the Hadoop File System (HDFS) ?? ") , so I now have a look at Apache CouchDB

(Via http://couchdb.apache.org/:) Apache CouchDB is a

• A document database server, accessible via a RESTful JSON API
• Ad-hoc and schema-free with a flat address space
• Distributed, featuring robust, incremental replication with bi-directional conflict detection and management
• Query-able and index-able, featuring a table oriented reporting engine that uses Javascript as a query language

Installation

Installing couchdb on my computer as easy as described on the wiki and after starting the default CouchDB server (host: localhost, port:5984) I got a {"couchdb":"Welcome","version":"0.10.0a769334"} when I opened my browser on http://localhost:5984/, as well as an interactive console at http://localhost:5984/_utils/.

.

Sending Request to CouchDB

Documents and Databases are created, deleted,found, etc.. using a REST protocol based on HTTP and its methods (GET/POST/PUT/DELETE/...). In order to play with this couchdb, I've created a small java program using the apache http client library (see source at the end of this post) (I know there is already a JAVA API for couchdb, but I wanted to be sure that I understand the concepts).

Creating a Database

First I want to create a database of Single Nucleotide Polymorphisms (SNPs): a PUT request is sent with the name of the database http://localhost:5984/position2snp

public void createDatabase(String database) throws IOException
{
PutMethod method= new PutMethod("http://localhost:5984/"+database);
HttpClient client=new HttpClient();
client.executeMethod(method);
method.releaseConnection();
}

And couchdb returns the following JSON object.

{"ok":true}

Listing the databases

A special identifier (_all_dbs) in the request path and a GET method are used to to get all the databases:

public void getAllDatabases() throws IOException
{
GetMethod method= new GetMethod("http://localhost:5984/_all_dbs");
HttpClient client=new HttpClient();
client.executeMethod(method);
method.releaseConnection();
}

And couchdb returns the following JSON array containing the one and only database:

["position2snp"]

Adding some SNPs in the Database

CouchDB is a key/value store of JSON-based document. Here the KEY will be a fixed-size (We'll use some '0' for padding) concatenation of the chromosome and the genomic position for each SNP e.g. "chr01_00000006".

static String formatPosition(int chromosome,int position)
{
StringWriter w= new StringWriter();
PrintWriter out= new PrintWriter(w);
out.printf("chr%02d_%08d", chromosome,position);
return w.toString();
}

The VALUE will be a structured description of the SNP. Here I've simulated a set of random SNP.

Random rand= new Random();
for(int i=0;i< 50;++i)
{
int chromosome= 1+rand.nextInt(4);
int position = 1+rand.nextInt(100);
putDocument(POS2SNP,formatPosition(chromosome, position),
"{\"rs\":\"rs"+(i+1)+"\"," +
"\"avHet\":"+(rand.nextFloat()*0.5f)+"," +
"\"snpClass\":\""+(i%2==0?"mutation":"silent")+"\"," +
"\"mapping\":{" +
"\"chromosome\":\"chr"+chromosome+"\"," +
"\"position\":"+position+"" +
"}}");
}

The new document is loaded by sending a PUT request, with the structured description of the SNP in the body of the request, to "http://localhost:5984/position2snp/THE_KEY" and .

public void putDocument(String id,String json) throws IOException
{
PutMethod method= new PutMethod("http://localhost:5984/position2snp/"+id);
method.setRequestEntity(new StringRequestEntity(json,"application/json", "UTF-8"));
HttpClient client=new HttpClient();
client.executeMethod(method);
method.releaseConnection();
}

(Note: the POST method can be used instead of PUT to generate a unique key for a document)
For example, when I post a new SNP, couchdb returns the following JSON object containing the status ("ok"), the id/key of the new document/snp and its revision-id:

{"ok":true,"id":"chr02_00000081","rev":"1-948851818"}

Retrieving only one row in the Database

A GET request is sent with the special keyword _all_docs and the parameter limit. e.g: " http://localhost:5984/position2snp/_all_docs?limit=1".
Couchdb returns the following JSON object:

{"total_rows":49,"offset":0,"rows":[
{"id":"chr01_00000006","key":"chr01_00000006","value":{"rev":"1-1656436337"}}
]}

Retrieving the document from its KEY/ID

A GET request is sent to http://localhost:5984/position2snp/THE_KEY
For example sending http://localhost:5984/position2snp/chr03_00000046 returns:

{"_id":"chr03_00000046","_rev":"1-3263055450","rs":"rs9","avHet":0.09515628,"snpClass":"mutation","mapping":{"chromosome":"chr3","position":46}}

If the KEY was not found when sending http://localhost:5984/position2snp/chr03_00000000 , Couchdb returns:

{"error":"not_found","reason":"missing"}

Finding all the SNPs in a defined Genomic Segment

As the KEYs are sorted, have the same length, and define the position of the SNP on the genome, we can search CouchDB for all the SNPs in a defined region of the genome by sending a GET HTTP request with the parameters startkey and endkey. For example, if we want all the SNPs on the chromosome 2 between the bases 30 and 60 we send http://localhost:5984/position2snp/_all_docs?startkey=%22chr02_00000030%22&endkey=%22chr02_00000060%22 and the result is:

{"total_rows":47,"offset":18,"rows":[
{"id":"chr02_00000032","key":"chr02_00000032","value":{"rev":"1-4178679245"}},
{"id":"chr02_00000040","key":"chr02_00000040","value":{"rev":"1-392133644"}},
{"id":"chr02_00000056","key":"chr02_00000056","value":{"rev":"1-3847661844"}}
]}

Views

Views are the primary tool used for querying and reporting on CouchDB documents. Views are stored inside special documents called design documents, and can be accessed via an HTTP GET request to the URI /{dbname}/{docid}/{viewname} . The view is defined by a JavaScript function that MAPs view keys to values. If a view has a REDUCE function, it is used to produce aggregate results for that view. A reduce function is passed a set of intermediate values and combines them to a single value. Reduce functions must accept, as input, results emitted by its corresponding MAP function

We upload our view called _design/genotypage:

putDocument("position2snp","_design/genotypage",
"{\"views\":{" +
"\"snpMutation\":{ \"map\":\"function(doc) {if(doc.snpClass='mutation') emit(null,doc); }\"},"+
"\"snpByClass\":{ \"map\":\"function(doc) { emit(doc.snpClass,doc.avHet); }\"},"+
"\"snpByName\":{ \"map\":\"function(doc) { emit(doc.rs,doc); }\"},"+
"\"snpByClassMaxHet\":{" +
"\"map\":\"function(doc) { emit(doc.snpClass,doc.avHet); }\"," +
"\"reduce\":\"function(keys, values) { var mean=0.0; for ( var i = 0; i < values.length; ++i ) { mean+=values[i];} return mean/(values.length);}\"" +
"}"+
"}}" +
"");

This view contains four functions: snpMutation, snpByClass, snpByName and snpByClassMaxHet

Find all SNPs having a class='mutation'

A GET request is sent to "http://localhost:5984/position2snp/_design/genotypage/_view/snpMutation" and couchdb returns

{"total_rows":47,"offset":0,"rows":[
{"id":"chr01_00000001","key":null,"value":{"_id":"chr01_00000001","_rev":"1-3508311375","rs":"rs12","avHet":0.30527565,"snpClass":"mutation","mapping":{"chromosome":"chr1","position":1}}},
{"id":"chr01_00000006","key":null,"value":{"_id":"chr01_00000006","_rev":"1-3309871741","rs":"rs31","avHet":0.30192727,"snpClass":"mutation","mapping":{"chromosome":"chr1","position":6}}},
{"id":"chr01_00000009","key":null,"value":{"_id":"chr01_00000009","_rev":"1-4077528375","rs":"rs3","avHet":0.44473252,"snpClass":"mutation","mapping":{"chromosome":"chr1","position":9}}},
{"id":"chr01_00000015","key":null,"value":{"_id":"chr01_00000015","_rev":"1-247108112","rs":"rs17","avHet":0.42058986,"snpClass":"mutation","mapping":{"chromosome":"chr1","position":15}}},
{"id":"chr01_00000016","key":null,"value":{"_id":"chr01_00000016","_rev":"1-3568315779","rs":"rs43","avHet":0.4113328,"snpClass":"mutation","mapping":{"chromosome":"chr1","position":16}}},
(...)
{"id":"chr04_00000033","key":null,"value":{"_id":"chr04_00000033","_rev":"1-3823284043","rs":"rs20","avHet":0.17454243,"snpClass":"mutation","mapping":{"chromosome":"chr4","position":33}}},
{"id":"chr04_00000035","key":null,"value":{"_id":"chr04_00000035","_rev":"1-1400920328","rs":"rs10","avHet":0.33354515,"snpClass":"mutation","mapping":{"chromosome":"chr4","position":35}}},
{"id":"chr04_00000045","key":null,"value":{"_id":"chr04_00000045","_rev":"1-3632023176","rs":"rs49","avHet":0.44040334,"snpClass":"mutation","mapping":{"chromosome":"chr4","position":45}}},
{"id":"chr04_00000058","key":null,"value":{"_id":"chr04_00000058","_rev":"1-1711768614","rs":"rs14","avHet":0.3784455,"snpClass":"mutation","mapping":{"chromosome":"chr4","position":58}}}
]}

Create a table containing the snpClass and the avHet for each SNP

A GET request is sent to "method http://localhost:5984/position2snp/_design/genotypage/_view/snpByClass" and couchdb returns:

{"total_rows":47,"offset":0,"rows":[
{"id":"chr01_00000006","key":"mutation","value":0.30192727},
{"id":"chr01_00000009","key":"mutation","value":0.44473252},
{"id":"chr01_00000015","key":"mutation","value":0.42058986},
{"id":"chr01_00000016","key":"mutation","value":0.4113328},
(...)
{"id":"chr04_00000019","key":"silent","value":0.069098294},
{"id":"chr04_00000033","key":"silent","value":0.17454243},
{"id":"chr04_00000035","key":"silent","value":0.33354515},
{"id":"chr04_00000058","key":"silent","value":0.3784455}
]}

Find the snp named "rs1"

A GET request is sent to "http://localhost:5984/position2snp/_design/genotypage/_view/snpByName?key=%22rs1%22" , and using the request parameter key="rs1". Couchdb returns:

{"total_rows":47,"offset":0,"rows":[
{"id":"chr01_00000023","key":"rs1","value":{"_id":"chr01_00000023","_rev":"1-49396577","rs":"rs1","avHet":0.035366535,"snpClass":"mutation","mapping":{"chromosome":"chr1","position":23}}}
]}

Map/Reduce: map all the SNP by they snpClass and avHet. Reduce this map to have the mean avHet for the two types of snpClass

A GET request is sent to "http://localhost:5984/position2snp/_design/genotypage/_view/snpByClassMaxHet?group=true" using the request parameter group=true to group by snpClass. Couchdb returns:

{"rows":[
{"key":"mutation","value":0.29830500208},
{"key":"silent","value":0.2255268866772728}
]}

Dropping the Database

A DELETE request with the name of the database is sent to "http://localhost:5984/position2snp".

public void deleteDatabase(String database) throws IOException
{
DeleteMethod method= new DeleteMethod("http://localhost:5984/"+database);
HttpClient client=new HttpClient();
client.executeMethod(method);
method.releaseConnection();
}

And couchdb returns the following JSON object:

{"ok":true}

Source Code

package test;
import java.io.IOException;
import java.io.InputStream;
import java.io.PrintWriter;
import java.io.StringWriter;
import java.net.URLEncoder;

import java.util.ArrayList;
import java.util.List;
import java.util.Random;

import org.apache.commons.httpclient.HttpClient;
import org.apache.commons.httpclient.HttpMethod;
import org.apache.commons.httpclient.NameValuePair;
import org.apache.commons.httpclient.methods.DeleteMethod;
import org.apache.commons.httpclient.methods.GetMethod;
import org.apache.commons.httpclient.methods.PostMethod;
import org.apache.commons.httpclient.methods.PutMethod;
import org.apache.commons.httpclient.methods.StringRequestEntity;
import org.lindenb.io.TInputStream;
import org.lindenb.json.Parser;
import org.lindenb.util.C;

public class CouchDBTest01
{
private static final int DEFAULT_PORT=5984;
private static final String DEFAULT_HOST="localhost";
private String host= DEFAULT_HOST;
private int port= DEFAULT_PORT;
private HttpClient client;

CouchDBTest01()
{
this.client = new HttpClient();
}

public String getHost()
{
return host;
}
public int getPort() {
return port;
}

private String getPath()
{
return "http://"+getHost()+":"+getPort();
}

private Object parseResult(String message,HttpMethod method)throws IOException
{
System.err.println("\n#################" + message+"#####################");

System.err.println("Sending :"+ method.getName()+" method "+getPath()+method.getPath()+(method.getQueryString()==null?"":"?"+method.getQueryString()));


this.client.executeMethod(method);
InputStream in=method.getResponseBodyAsStream();
in= new TInputStream(in,System.out);
Object o= new Parser().parse(in);
in.close();
method.releaseConnection();
return o;
}


public void createDatabase(String database) throws IOException
{
PutMethod method= new PutMethod(getPath()+"/"+database);
parseResult("Create database "+database,method);
}


public void deleteDatabase(String database) throws IOException
{
DeleteMethod method= new DeleteMethod(getPath()+"/"+database);
parseResult("Drop database "+database,method);
}

public void getAllDatabases() throws IOException
{
GetMethod method= new GetMethod(getPath()+"/"+"_all_dbs");
parseResult("Get All Databases",method);

}

public void getDocument(String database,String docid) throws IOException
{
GetMethod method= new GetMethod(getPath()+"/"+database+"/"+docid);
parseResult("Get document "+docid,method);
}

public void putDocument(String database,String docid,String json) throws IOException
{
PutMethod method= new PutMethod(getPath()+"/"+database+"/"+docid);
method.setRequestEntity(new StringRequestEntity(json,"application/json", "UTF-8"));
parseResult("Create document "+docid,method);
}

public void putDocument(String database,String json) throws IOException
{
PostMethod method= new PostMethod(getPath()+"/"+database+"/");
method.setRequestEntity(new StringRequestEntity(json,"application/json", "UTF-8"));
parseResult("Create document",method);
}

public void getDocuments(String database,
String startkey,
String endkey,
Integer limit,
Boolean descending
) throws IOException
{
List<NameValuePair> params= new ArrayList<NameValuePair>();
if(startkey!=null) params.add(new NameValuePair("startkey",startkey));
if(endkey!=null) params.add(new NameValuePair("endkey",endkey));
if(limit!=null) params.add(new NameValuePair("limit",limit.toString()));
if(descending!=null) params.add(new NameValuePair("descending",descending.toString()));

GetMethod method= new GetMethod(getPath()+"/"+database+"/"+"_all_docs");
method.setQueryString(params.toArray(new NameValuePair[params.size()]));
parseResult("Get Documents",method);
}

static String formatPosition(int chrom,int position)
{
StringWriter w= new StringWriter();
PrintWriter out= new PrintWriter(w);
out.printf("chr%02d_%08d", chrom,position);
return w.toString();
}

static String quote(String s)
{
return "\""+C.escape(s)+"\"";
}


void makeTest() throws IOException
{
final String POS2SNP="position2snp";
createDatabase(POS2SNP);
getAllDatabases();


Random rand= new Random();
for(int i=0;i< 50;++i)
{
int chromosome= 1+rand.nextInt(4);
int position = 1+rand.nextInt(100);
putDocument(POS2SNP,formatPosition(chromosome, position),
"{\"rs\":\"rs"+(i+1)+"\"," +
"\"avHet\":"+(rand.nextFloat()*0.5f)+"," +
"\"snpClass\":\""+(i%2==0?"mutation":"silent")+"\"," +
"\"mapping\":{" +
"\"chromosome\":\"chr"+chromosome+"\"," +
"\"position\":"+position+"" +
"}}");
getDocument(POS2SNP,formatPosition(chromosome, 0));
}



getDocuments(POS2SNP,null,null,1,null);

getDocuments(POS2SNP,quote(formatPosition(2, 30)),quote(formatPosition(2, 60)),null,null);

putDocument(POS2SNP,"_design/genotypage",
"{\"views\":{" +
"\"snpMutation\":{ \"map\":\"function(doc) {if(doc.snpClass='mutation') emit(null,doc); }\"},"+
"\"snpByClass\":{ \"map\":\"function(doc) { emit(doc.snpClass,doc.avHet); }\"},"+
"\"snpByName\":{ \"map\":\"function(doc) { emit(doc.rs,doc); }\"},"+
"\"snpByClassMaxHet\":{" +
"\"map\":\"function(doc) { emit(doc.snpClass,doc.avHet); }\"," +
"\"reduce\":\"function(keys, values) { var mean=0.0; for ( var i = 0; i < values.length; ++i ) { mean+=values[i];} return mean/(values.length);}\"" +
"}"+
"}}" +
"");

GetMethod method= new GetMethod(getPath()+"/"+POS2SNP+"/_design/genotypage/_view/snpMutation");
parseResult("Map1",method);
method= new GetMethod(getPath()+"/"+POS2SNP+"/_design/genotypage/_view/snpByClass");
parseResult("Map2",method);
method= new GetMethod(getPath()+"/"+POS2SNP+"/_design/genotypage/_view/snpByClassMaxHet");
method.setQueryString("group=true");
parseResult("Map3",method);
method= new GetMethod(getPath()+"/"+POS2SNP+"/_design/genotypage/_view/snpByName");
method.setQueryString("key="+URLEncoder.encode("\"rs1\"","UTF8"));
parseResult("Map4",method);


deleteDatabase(POS2SNP) ;
}

public static void main(String[] args) {
try {
int optind=0;
CouchDBTest01 app=new CouchDBTest01();
while(optind<args.length)
{
if(args[optind].equals("-h"))
{
System.err.println("Pierre Lindenbaum PhD.");
System.err.println("-h this screen");
System.err.println("-H (host)");
System.err.println("-p (port)");
System.err.println("-d debug");
return;
}
else if (args[optind].equals("-H"))
{
app.host=args[++optind];
}
else if (args[optind].equals("-p"))
{
app.port=Integer.parseInt(args[++optind]);
}
else if (args[optind].equals("--"))
{
++optind;
break;
}
else if (args[optind].startsWith("-"))
{
System.err.println("bad argument " + args[optind]);
System.exit(-1);
}
else
{
break;
}
++optind;
}
app.makeTest();

} catch (Exception e) {
e.printStackTrace();
}
}
}

An extension for MediaWiki: displaying a DNA sequence

This post is about a new extension for MediaWiki (the wiki engine of wikipedia written in PHP). This was the first extension I wrote: this extension add a new custom tag <dnaseq> and it simply displays a DNA sequence. Here is a screenshot of this extension installed in my local mediawiki.

and the source code for this extension is available here:

http://code.google.com/p/lindenb/source/browse/trunk/proj/mediawiki/extensions/dnaseq/dnaseq.php

First we tell MediaWiki about this new extension in ${MWROOT}/LocalSettings.php

require_once("$IP/extensions/dnaseq/dnaseq.php");

Then we install this new feature which is a new TAG named <dnaseq>. Each time the mediawiki will find a <dnaseq> , the function myRenderDnaSequence will be called.

$wgHooks['ParserFirstCallInit'][] = 'myDnaSequence';
(...)
function myDnaSequence()
{
global $wgParser;
$wgParser->setHook( 'dnaseq', 'myRenderDnaSequence' );
return true;
}

myRenderDnaSequence is the function returning the formatted DNA sequence:

function myRenderDnaSequence( $input, $args, $parser )
{
if($input==null) return "";
$len= strlen($input);
$n=0;
$html="<div style='padding: 10px; font-size:10px; border-width: thin; border: 1px black solid; white-space: pre;background-color: white;font-family: courier, monospace;line-height:13px; font-size:12px;'>";
for($i=0;$i< $len;$i++)
{
$c = $input[$i];
if(ctype_space($c) || ctype_digit($c)) continue;
if($n % 60 == 0)
{
if($n!=0) $html.="<br/>";
$html.= sprintf("%06d ",($n+1));
}
else if($n % 10 ==0)
{
$html.=" ";
}
$n++;
switch(strtolower($c))
{
case "a":
$html.="<span style='color:green;'>".$c."</span>";
break;
case "c":
$html.="<span style='color:blue;'>".$c."</span>";
break;
case "g":
$html.="<span style='color:black;'>".$c."</span>";
break;
case "t":
case "u":
$html.="<span style='color:red'>".$c."</span>";
break;
default:
$html.="<span style='text-decoration:blink;color:gray'>".$c."</span>";
break;
}
if($n % 60 == 0)
{
$html.= sprintf(" %06d",($n));
}
}
$html .= "</div>";
return $html;
}

That's it.
Pierre

Knime.org: creating a new Source Node reading Fasta sequences.

This blog is about how I wrote a java plugin for the workflow engine KNIME (http://www.knime.org). This plugin reads a FASTA file containing one or more sequence and transforms it into a table containing to columns: one for the name of the sequence and the other for the sequence itself.

In the last weeks , I've been looking for a workflow engine that could be easily handled by the members of my lab. I tested three tools:

• Taverna (now in version 2) is mainly devoted to the web services. I've been trying to learn how to use Taverna a few times but I still don't find it user-friendly, not intuitive
• http://kepler-project.org/: 141Mo ! Ouch !
• http://www.knime.org: until the last version , the development version crashed at startup on my computer, but now everything works fine

KNime - The Konstanz Information Miner is a modular environment -, which enables easy visual assembly and interactive execution of a data pipeline. Knime is built over eclipse and each node in the workflow is developed as a plugin. As far as I understand Knime, it only handles tabular data and that's why I wrote this new plugin converting a set of fasta files. The Knime SDK comes with a dialog wizard creating a the java stubs required to create a new KNime node. Here are a few files:

XXXNodeModel

implements the logic of the node. The most important method

BufferedDataTable[] execute(finalBufferedDataTable[] inData,
    final ExecutionContext exec) throws Exception

takes as input one or more table, transforms it and returns an array of one or more table

XXXNodeDialog

A Swing-based dialog used to select the option of a node. Here, I've created a dialog selecting the fasta file

XXXNodeView

Visualizes the result of the node. Here, I didn't wrote a view but one could imagine a graphical interface drawing the GC%, etc...

XXXNodeFactory

A class generating the model, the dialog the views, ...

XXXNodePlugin

Describes the plugin. It is only used by eclipse

The sources I wrote are available here: warning, the sources are a draft and I'm still learning the Knime API, I guess there must have cleaver/smarter/safer way to write this stuff

• FastaIterator.java: iterator over a fasta file
• FastaTable.java: the tabular representation of the sequences. It contains two columns Name and Sequence
• ReadFastaNodeDialog.java: the dialog selecting the fasta file
• ReadFastaNodeFactory.java: the node factory
• ReadFastaNodeModel.java: implements the logic of the node. Creates and returns the FastaTable
• /ReadFastaNodePlugin: used by eclipse

Here is a screenshot: my Node reads a fasta file and transforms it into a two-columns table 'grep' all the sequences containing the word ONCOGENE, sort the sequences and output the result in a table (smaller window at the bottom).







That's it for tonight.

Pierre