LinkedIn+XSLT = FOAF / People from Biohackathon 2010

I've created a XSLT stylesheet transforming the public HTML pages on LinkedIn about the people going to Biohackathon 2010 to FOAF. The stylesheet worked fine (of course it won't work anymore if LinkedIn change the layout of the HTML pages) and it is available here:

http://code.google.com/p/lindenb/source/browse/trunk/src/xsl/linkedin2foaf.xsl

Note: if possible, the XSLT stylesheet uses geonames.org to find the foaf:based_near. At the end, here is the FOAF file of the people attending Biohackathon 2010:

<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:foaf="http://xmlns.com/foaf/0.1/" xmlns:geo="http://www.w3.org/2003/01/geo/wgs84_pos#" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:vcard="http://www.w3.org/2001/vcard-rdf/3.0#" xmlns:doac="http://ramonantonio.net/doac/0.1/">
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=11054862">
<foaf:name>Alberto Labarga</foaf:name>
<foaf:givenname>Alberto</foaf:givenname>
<foaf:family_name>Labarga</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/1/000/002/120/050aad5.jpg">
<dc:title>Alberto Labarga</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>CEO at Experimental Serendipity</doac:summary>
<doac:skill>building</doac:skill>
<doac:skill>team</doac:skill>
<doac:skill>management</doac:skill>
<doac:skill>project</doac:skill>
<doac:skill>design</doac:skill>
<doac:skill>visual</doac:skill>
<doac:skill>architecture</doac:skill>
<doac:skill>information</doac:skill>
<doac:skill>SOA</doac:skill>
<doac:skill>analysis</doac:skill>
<doac:skill>data</doac:skill>
<doac:skill>mining</doac:skill>
<doac:skill>data</doac:skill>
<doac:skill>ELN)</doac:skill>
<doac:skill>HIS</doac:skill>
<doac:skill>LIS</doac:skill>
<doac:skill>(LIMS</doac:skill>
<doac:skill>management</doac:skill>
<doac:skill>data</doac:skill>
<doac:skill>scientific</doac:skill>
<doac:skill>bioinformatics</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>LIMS Consultant</doac:title>
<doac:location>LabWare</doac:location>
<doac:date-starts>2009-10-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Information Architect and Data analysis consultant</doac:title>
<doac:location>Experimental Serendipity</doac:location>
<doac:date-starts>2008-10-01</doac:date-starts>
<doac:activity>We work with companies who want to get more value from their information. We help them develop new ways to manage, analyze and visualize their information. We are currently working in different web 2.0 related projects, including the Elsevier Grand Challenge (http://www.elseviergrandchallenge.com) and the Webservices BioHackaton (http://hackathon2.dbcls.jp/)</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>PhD student</doac:title>
<doac:location>Universidad de Granada</doac:location>
<doac:date-starts>2008-10-01</doac:date-starts>
<doac:activity>I am currently finishing my PhD studies in the genome Alhambra group (http://genome.ugr.es/), within the Computer Science and Artificial Intelligence Department. My thesis is focused in developing new data mining techniques for analysis and visualization in biomedicine..</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Coordinador Grupo de Voluntarios de Granada</doac:title>
<doac:location>Fundación Ayuda en Acción</doac:location>
<doac:date-starts>2007-12-01</doac:date-starts>
<doac:activity>Coordinador Grupo de Voluntarios de Granada</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Chief Technology Officer</doac:title>
<doac:location>Integromics S.L.</doac:location>
<doac:date-starts>2007-11-01</doac:date-starts>
<doac:date-ends>2008-10-01</doac:date-ends>
<doac:activity>I have led the development, from inception to implementation, of a microarray data analytics product based on the TIBCO Spotfire platform (http://www.integromics.com/IBD.php) and a laboratory and clinical data management system based on the Apache Cocoon framework and other Java technologies such as Xindice or JMaki.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Software Engineer</doac:title>
<doac:location>EBI</doac:location>
<doac:date-starts>2005-06-01</doac:date-starts>
<doac:date-ends>2007-11-01</doac:date-ends>
<doac:activity>I worked in the External Services Group, which is part of the IT Services Department, where I lead the migration of the EBI databases and applications infrastructure to a Services Oriented Architecture (SOA). I was involved in the development of the new unified website and the new search engine EB-Eye. My daily work included modelling, design and software development. Also I was responsible for the web infrastructure (Apache and Tomcat servers). This position also involved training and dissemination tasks related to EBI services in courses, workshops, conferences, etc.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Chief Technology Officer</doac:title>
<doac:location>IMAGINA BIOTEK</doac:location>
<doac:date-starts>2002-10-01</doac:date-starts>
<doac:date-ends>2005-12-01</doac:date-ends>
<doac:activity>I was in charge of the technical direction and research project coordination at this bioinformatics start-up company. Between our contracts we had the management of the bioinformatics infrastructure of the Applied Medicine Research Center (www.cima.es) in Pamplona (Spain) and the bioinformatics support of the main Affymetrix service provider in Spain (www.progenika.com). We took part in different joint research projects at national and european levels, with cancer being one of our main collaboration topics with the Universitary Hospital and the University of Navarra.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Associate Professor</doac:title>
<doac:location>Universidad Pública de Navarra</doac:location>
<doac:date-starts>1997-10-01</doac:date-starts>
<doac:date-ends>2005-06-01</doac:date-ends>
<doac:activity>I taught different subjects related to Digital Signal Processing for Telecommunication Engineering students and Computer Science and Programming for Civil Engineers. I was also the coordinator of the research line in bioinformatics in the Health Sciences School.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Researcher</doac:title>
<doac:location>CEIT</doac:location>
<doac:date-starts>2000</doac:date-starts>
<doac:date-ends>2002</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Universidad de Granada</foaf:organization>
<doac:title>PhD. in Computer Science and Artificial Intelligence</doac:title>
<doac:date-starts>2008-01-01</doac:date-starts>
<doac:date-ends>2009-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Universidad Complutense de Madrid</foaf:organization>
<doac:title>Experto en habilidades Directivas y Gestión de Equipos</doac:title>
<doac:date-starts>1998-01-01</doac:date-starts>
<doac:date-ends>1999-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Universidad Pública de Navarra</foaf:organization>
<doac:title>MSc. in Telecomunication Engineer</doac:title>
<doac:date-starts>1991-01-01</doac:date-starts>
<doac:date-ends>1997-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>University of Surrey</foaf:organization>
<doac:title>MSc. in Information Systems</doac:title>
<doac:date-starts>1994-01-01</doac:date-starts>
<doac:date-ends>1995-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=11054862">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=3144981">
<foaf:name>Andrea Splendiani</foaf:name>
<foaf:givenname>Andrea</foaf:givenname>
<foaf:family_name>Splendiani</foaf:family_name>
<doac:summary>Senior Bioinformatics Scientist - Data Integration at Rothamsted Research</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>London, GB</dc:title>
<geo:long>-0.125532746315002</geo:long>
<geo:lat>51.5084152563931</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://www.sgtp.net/AndreaSplendiani/"/>
<foaf:homepage rdf:resource="http://www.leafbioscience.com"/>
<foaf:homepage rdf:resource="http://sergentpenguin.blogspot.com"/>
<doac:skill>Databases</doac:skill>
<doac:skill>Microarrays</doac:skill>
<doac:skill>Pathways</doac:skill>
<doac:skill>Biology</doac:skill>
<doac:skill>Systems</doac:skill>
<doac:skill>Web</doac:skill>
<doac:skill>Semantic</doac:skill>
<doac:skill>Ontologies</doac:skill>
<foaf:homepage rdf:resource="http://www.sgtp.net/AndreaSplendiani/"/>
<foaf:homepage rdf:resource="http://www.leafbioscience.com"/>
<foaf:homepage rdf:resource="http://sergentpenguin.blogspot.com"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=3144981">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=34738971">
<foaf:name>Atsuko Yamaguchi</foaf:name>
<foaf:givenname>Atsuko</foaf:givenname>
<foaf:family_name>Yamaguchi</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/1/000/047/16f/1b494b3.jpg">
<dc:title>Atsuko Yamaguchi</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Project Associate Professor at Database Center for Life Science</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://dbcls.rois.ac.jp/"/>
<foaf:homepage rdf:resource="http://lifesciencedb.jp/"/>
<doac:experience>
<doac:Experience>
<doac:title>Project Associate Professor</doac:title>
<doac:location>Database Center for Life Science</doac:location>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Assistant Professor</doac:title>
<doac:location>Kyoto University</doac:location>
<doac:date-starts>2002-04-01</doac:date-starts>
<doac:date-ends>2005-03-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Kyoto University</foaf:organization>
<doac:title>Ph.D</doac:title>
<doac:subject/>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Kyushu University</foaf:organization>
<doac:title>MS</doac:title>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://dbcls.rois.ac.jp/"/>
<foaf:homepage rdf:resource="http://lifesciencedb.jp/"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=34738971">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=18346806">
<foaf:name>Bruno Aranda</foaf:name>
<foaf:givenname>Bruno</foaf:givenname>
<foaf:family_name>Aranda</foaf:family_name>
<doac:summary>Software Engineer at European Bioinformatics Institute</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Cambridge, GB</dc:title>
<geo:long>0.1166667</geo:long>
<geo:lat>52.2</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://www.ebi.ac.uk"/>
<foaf:homepage rdf:resource="http://myfaces.apache.org"/>
<doac:skill>JSF.</doac:skill>
<doac:skill>and</doac:skill>
<doac:skill>Java</doac:skill>
<doac:skill>in</doac:skill>
<doac:skill>Specialist</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>Software Engineer</doac:title>
<doac:location>European Bioinformatics Institute</doac:location>
<doac:date-starts>2006-03-01</doac:date-starts>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>PMC Member</doac:title>
<doac:location>Apache Software Foundation</doac:location>
<doac:date-starts>2006-02-01</doac:date-starts>
<doac:activity>PMC Member of the Apache MyFaces project (http://myfaces.apache.org)</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Committer</doac:title>
<doac:location>Apache Software Foundation</doac:location>
<doac:date-starts>2005-06-01</doac:date-starts>
<doac:activity>Committer for Apache MyFaces (http://myfaces.apache.org)</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Software Engineer</doac:title>
<doac:location>Ebiointel</doac:location>
<doac:date-starts>2002-09-01</doac:date-starts>
<doac:date-ends>2006-02-01</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Software Developer</doac:title>
<doac:location>e-ntra</doac:location>
<doac:date-starts>2000-04-01</doac:date-starts>
<doac:date-ends>2002-08-01</doac:date-ends>
<doac:activity>Part-time</doac:activity>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Universitat Autònoma de Barcelona</foaf:organization>
<doac:title/>
<doac:date-starts>1998-01-01</doac:date-starts>
<doac:date-ends>2002-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://www.ebi.ac.uk"/>
<foaf:homepage rdf:resource="http://myfaces.apache.org"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=18346806">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=17090435">
<foaf:name>Christian Zmasek</foaf:name>
<foaf:givenname>Christian</foaf:givenname>
<foaf:family_name>Zmasek</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/1/000/048/104/1280869.jpg">
<dc:title>Christian Zmasek</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Postdoctoral Associate at Burnham Institute for Medical Research</doac:summary>
<foaf:homepage rdf:resource="http://monochrome-effect.net/publications.html"/>
<foaf:homepage rdf:resource="http://monochrome-effect.net/"/>
<foaf:homepage rdf:resource="http://bioinformatics.burnham.org/pages/index.html"/>
<doac:skill>SQL.</doac:skill>
<doac:skill>Perl</doac:skill>
<doac:skill>C++</doac:skill>
<doac:skill>Ruby</doac:skill>
<doac:skill>Java</doac:skill>
<doac:skill>languages:</doac:skill>
<doac:skill>Programming</doac:skill>
<doac:skill>+</doac:skill>
<doac:skill>culture.</doac:skill>
<doac:skill>cell</doac:skill>
<doac:skill>(ES)</doac:skill>
<doac:skill>stem</doac:skill>
<doac:skill>embryonic</doac:skill>
<doac:skill>and</doac:skill>
<doac:skill>techniques;</doac:skill>
<doac:skill>microscopy</doac:skill>
<doac:skill>analysis;</doac:skill>
<doac:skill>and</doac:skill>
<doac:skill>purification</doac:skill>
<doac:skill>expression</doac:skill>
<doac:skill>protein</doac:skill>
<doac:skill>analysis;</doac:skill>
<doac:skill>and</doac:skill>
<doac:skill>manipulation</doac:skill>
<doac:skill>isolation</doac:skill>
<doac:skill>DNA</doac:skill>
<doac:skill>in</doac:skill>
<doac:skill>Experienced</doac:skill>
<doac:skill>Biology:</doac:skill>
<doac:skill>Molecular</doac:skill>
<doac:skill>+</doac:skill>
<doac:skill>development.</doac:skill>
<doac:skill>algorithm</doac:skill>
<doac:skill>analysis</doac:skill>
<doac:skill>sequence</doac:skill>
<doac:skill>protein</doac:skill>
<doac:skill>and</doac:skill>
<doac:skill>DNA</doac:skill>
<doac:skill>Biology:</doac:skill>
<doac:skill>Computational</doac:skill>
<doac:skill>Genomics</doac:skill>
<doac:skill>+</doac:skill>
<doac:skill>analysis.</doac:skill>
<doac:skill>functional</doac:skill>
<doac:skill>wide</doac:skill>
<doac:skill>genome</doac:skill>
<doac:skill>and</doac:skill>
<doac:skill>inference</doac:skill>
<doac:skill>duplication</doac:skill>
<doac:skill>gene</doac:skill>
<doac:skill>analysis</doac:skill>
<doac:skill>phylogenetic</doac:skill>
<doac:skill>in</doac:skill>
<doac:skill>experience</doac:skill>
<doac:skill>Extensive</doac:skill>
<doac:skill>Evolution:</doac:skill>
<doac:skill>Molecular</doac:skill>
<doac:skill>+</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>Postdoctoral Associate</doac:title>
<doac:location>Burnham Institute for Medical Research</doac:location>
<doac:date-starts>2006-06-01</doac:date-starts>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Principal Investigator</doac:title>
<doac:location>Genomics Institute of the Novartis Research Foundation (GNF)</doac:location>
<doac:date-starts>2002-03-01</doac:date-starts>
<doac:date-ends>2006-06-01</doac:date-ends>
<doac:activity>Research projects I worked on: + Large scale phylogenetic analyses of multiple ion channel gene families from species ranging from Ciona intestinalis to mammals + Phylogenetic analysis of non-protein kinases + Text and data mining + Statistical analyses of high throughput functional cell based cDNA and siRNA screening experiments + mRNA expression analyses Furthermore, I spent significant time developing software (J2EE, Oracle, Perl).</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Intern</doac:title>
<doac:location>Monsanto Company</doac:location>
<doac:date-starts>1998-06-01</doac:date-starts>
<doac:date-ends>1998-08-01</doac:date-ends>
<doac:activity>I performed research on the reconstruction of signaling pathways by mining the knowledge present in scientific literature and databases.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Washington University in St. Louis School of Medicine</foaf:organization>
<doac:title>PhD</doac:title>
<doac:date-starts>1994-01-01</doac:date-starts>
<doac:date-ends>2002-12-31</doac:date-ends>
<doac:subject>Graduate work in molecular genetics and computational biology under thesis advisor Sean Eddy.</doac:subject>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Eidgenössische Technische Hochschule Zürich</foaf:organization>
<doac:title>Diploma</doac:title>
<doac:date-starts>1989-01-01</doac:date-starts>
<doac:date-ends>1994-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Kantonsschule im Lee, Winterthur</foaf:organization>
<doac:title>Matura Type C</doac:title>
<doac:date-starts>1985-01-01</doac:date-starts>
<doac:date-ends>1989-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://monochrome-effect.net/publications.html"/>
<foaf:homepage rdf:resource="http://monochrome-effect.net/"/>
<foaf:homepage rdf:resource="http://bioinformatics.burnham.org/pages/index.html"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=17090435">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=65214809">
<foaf:name>Luke McCarthy</foaf:name>
<foaf:givenname>Luke</foaf:givenname>
<foaf:family_name>McCarthy</foaf:family_name>
<doac:summary>Programmer at The University of British Columbia</doac:summary>
<doac:experience>
<doac:Experience>
<doac:title>Programmer</doac:title>
<doac:location>The University of British Columbia</doac:location>
<doac:date-starts>2007-07-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Queen's University</foaf:organization>
<doac:title>BSCH</doac:title>
<doac:date-starts>1997-01-01</doac:date-starts>
<doac:date-ends>2001-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=65214809">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=14919228">
<foaf:name>François Belleau</foaf:name>
<foaf:givenname>François</foaf:givenname>
<foaf:family_name>Belleau</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/1/000/048/18b/316de1e.jpg">
<dc:title>François Belleau</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Bioinformatician at bio2rdf.org</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Quebec City, CA</dc:title>
<geo:long>-71.2145376205444</geo:long>
<geo:lat>46.8122791164294</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://bio2rdf.org"/>
<foaf:homepage rdf:resource="http://bio2rdf.blogspot.com/"/>
<doac:skill>applications</doac:skill>
<doac:skill>oriented</doac:skill>
<doac:skill>Service</doac:skill>
<doac:skill>databases</doac:skill>
<doac:skill>Bioinformatics</doac:skill>
<doac:skill>web</doac:skill>
<doac:skill>Semantic</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>Bioinformatician</doac:title>
<doac:location>bio2rdf.org</doac:location>
<doac:date-starts>2005</doac:date-starts>
<doac:activity>I am the main designer of the Bio2RDF project.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Master Student in Bioinformatics</doac:title>
<doac:location>Centre de recherche du CHUL/CHUQ</doac:location>
<doac:date-starts>2005</doac:date-starts>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Architecte technologique</doac:title>
<doac:location>Ministère du Développement économique, de l'Innovation et de l'Exportation (MDEIE)</doac:location>
<doac:date-starts>1998-02-01</doac:date-starts>
<doac:activity>I work as a technology specialist in all kinds of project where IT is involved like : CRM, web site, security, technological infrastructure, etc.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Technology architect</doac:title>
<doac:location>Ministère du Développement économique du Québec</doac:location>
<doac:date-starts>1998</doac:date-starts>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Architecte de données</doac:title>
<doac:location>MDEIE - Gouvernement du Québec</doac:location>
<doac:date-starts>1998</doac:date-starts>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Administrateur des services informatiques centraux</doac:title>
<doac:location>Ministère des affaires municipales du Québec (MAM)</doac:location>
<doac:date-starts>1993-02-01</doac:date-starts>
<doac:date-ends>1998-02-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Responsable de la sécurité informatique</doac:title>
<doac:location>Commission de la santé et de la sécurité du travail (CSST)</doac:location>
<doac:date-starts>1989-10-01</doac:date-starts>
<doac:date-ends>1993-02-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Université Laval</foaf:organization>
<doac:title>Master</doac:title>
<doac:date-starts>2005-01-01</doac:date-starts>
<doac:date-ends>2007-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Université Laval</foaf:organization>
<doac:title>Baccalaureat</doac:title>
<doac:date-starts>1985-01-01</doac:date-starts>
<doac:date-ends>1988-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://bio2rdf.org"/>
<foaf:homepage rdf:resource="http://bio2rdf.blogspot.com/"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=14919228">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=10344427">
<foaf:name>Fumikazu KONISHI</foaf:name>
<foaf:givenname>Fumikazu</foaf:givenname>
<foaf:family_name>KONISHI</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/2/000/019/080/3e4f230.jpg">
<dc:title>Fumikazu KONISHI</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Associate Professor at Tokyo Institute of Technology</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://www.titech.ac.jp"/>
<foaf:homepage rdf:resource="http://www.bi.cs.titech.ac.jp/~konishi"/>
<foaf:homepage rdf:resource="http://www.titech.ac.jp"/>
<foaf:homepage rdf:resource="http://www.bi.cs.titech.ac.jp/~konishi"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=10344427">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=27429075">
<foaf:name>Gos Micklem</foaf:name>
<foaf:givenname>Gos</foaf:givenname>
<foaf:family_name>Micklem</foaf:family_name>
<doac:summary>Dr at University of Cambridge</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Cambridge, GB</dc:title>
<geo:long>0.1166667</geo:long>
<geo:lat>52.2</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:experience>
<doac:Experience>
<doac:title>Dr</doac:title>
<doac:location>University of Cambridge</doac:location>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Imperial College London</foaf:organization>
<doac:title/>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>University of Cambridge</foaf:organization>
<doac:title>PhD</doac:title>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=27429075">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=61848948">
<foaf:name>Heiko Horn</foaf:name>
<foaf:givenname>Heiko</foaf:givenname>
<foaf:family_name>Horn</foaf:family_name>
<doac:summary>PhD student, Bioinformatician</doac:summary>
<doac:experience>
<doac:Experience>
<doac:title>PhD student</doac:title>
<doac:location>NNF Center for Protein Research, University of Copenhagen</doac:location>
<doac:date-starts>2009-08-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>University of Applied sciences, Giessen-Friedberg</foaf:organization>
<doac:title/>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=61848948">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=103859">
<foaf:name>James Taylor</foaf:name>
<foaf:givenname>James</foaf:givenname>
<foaf:family_name>Taylor</foaf:family_name>
<doac:summary>Assistant Professor at Emory University</doac:summary>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=103859">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=12968680">
<foaf:name>Jan Aerts</foaf:name>
<foaf:givenname>Jan</foaf:givenname>
<foaf:family_name>Aerts</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/1/000/000/239/2e061b0.jpg">
<dc:title>Jan Aerts</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Bioinformatician at Wellcome Trust Sanger Institute</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Cambridge, GB</dc:title>
<geo:long>0.1166667</geo:long>
<geo:lat>52.2</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://saaientist.blogspot.com"/>
<foaf:homepage rdf:resource="http://bioruby-annex.rubyforge.org"/>
<foaf:homepage rdf:resource="http://bio-graphics.rubyforge.org"/>
<doac:skill>programming</doac:skill>
<doac:skill>and</doac:skill>
<doac:skill>research</doac:skill>
<doac:skill>between</doac:skill>
<doac:skill>link</doac:skill>
<doac:skill>design</doac:skill>
<doac:skill>database</doac:skill>
<doac:skill>finemapping</doac:skill>
<doac:skill>QTL</doac:skill>
<doac:skill>integration</doac:skill>
<doac:skill>data</doac:skill>
<doac:skill>genomics</doac:skill>
<doac:skill>comparative</doac:skill>
<doac:skill>annotation</doac:skill>
<doac:skill>genome</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>Senior Bioinformatician</doac:title>
<doac:location>Wellcome Trust Sanger Institute</doac:location>
<doac:date-starts>2008-05-01</doac:date-starts>
<doac:activity>Analysis and visualization of large CNV datasets</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Bioinformatician</doac:title>
<doac:location>Roslin Institute</doac:location>
<doac:date-starts>2005-04-01</doac:date-starts>
<doac:date-ends>2008-03-01</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>PhD student</doac:title>
<doac:location>Wageningen University</doac:location>
<doac:date-starts>2001-01-01</doac:date-starts>
<doac:date-ends>2005-03-01</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Researcher</doac:title>
<doac:location>Janssen Pharmaceuticals</doac:location>
<doac:date-starts>2000-01-01</doac:date-starts>
<doac:date-ends>2001-01-01</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Katholieke Universiteit Leuven</foaf:organization>
<doac:title/>
<doac:date-starts>1999-01-01</doac:date-starts>
<doac:date-ends>2000-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Katholieke Universiteit Leuven</foaf:organization>
<doac:title>MSc</doac:title>
<doac:date-starts>1992-01-01</doac:date-starts>
<doac:date-ends>1998-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://saaientist.blogspot.com"/>
<foaf:homepage rdf:resource="http://bioruby-annex.rubyforge.org"/>
<foaf:homepage rdf:resource="http://bio-graphics.rubyforge.org"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=12968680">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=15498101">
<foaf:name>Jerven Bolleman</foaf:name>
<foaf:givenname>Jerven</foaf:givenname>
<foaf:family_name>Bolleman</foaf:family_name>
<doac:summary>Developer at Swiss Institute of Bioinformatics</doac:summary>
<doac:experience>
<doac:Experience>
<doac:title>Developer</doac:title>
<doac:location>Swiss Institute of Bioinformatics</doac:location>
<doac:date-starts>2008-02-01</doac:date-starts>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Software Engineer</doac:title>
<doac:location>Ordina</doac:location>
<doac:date-starts>2007-05-01</doac:date-starts>
<doac:date-ends>2008-01-01</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Trainee</doac:title>
<doac:location>EBI</doac:location>
<doac:date-starts>2005</doac:date-starts>
<doac:date-ends>2006</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Trainee</doac:title>
<doac:location>European Bioinformatics Institute</doac:location>
<doac:date-starts>2005</doac:date-starts>
<doac:date-ends>2006</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Trainee</doac:title>
<doac:location>EMBL-EBI, Cambridge, United Kingdom</doac:location>
<doac:date-starts>2005</doac:date-starts>
<doac:date-ends>2006</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Trainee</doac:title>
<doac:location>EMBL</doac:location>
<doac:date-starts>2005</doac:date-starts>
<doac:date-ends>2006</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Hanzehogeschool Groningen</foaf:organization>
<doac:title/>
<doac:date-starts>2002-01-01</doac:date-starts>
<doac:date-ends>2007-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=15498101">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=1510707">
<foaf:name>Pierre LINDENBAUM</foaf:name>
<foaf:givenname>Pierre</foaf:givenname>
<foaf:family_name>LINDENBAUM</foaf:family_name>
<doac:summary>Bioinformatician at CEPH, plindenbaum@yahoo.fr</doac:summary>
<foaf:homepage rdf:resource="http://plindenbaum.blogspot.com"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://friendfeed.com/yokofakun">
<foaf:accountName>yokofakun</foaf:accountName>
<foaf:accountServiceHomepage rdf:resource="http://friendfeed.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://twitter.com/yokofakun">
<foaf:accountName>yokofakun</foaf:accountName>
<foaf:accountServiceHomepage rdf:resource="http://twitter.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
<doac:experience>
<doac:Experience>
<doac:title>Bioinformatician</doac:title>
<doac:location>CEPH - Fondation Jean Dausset</doac:location>
<doac:date-starts>2008-09-01</doac:date-starts>
<doac:activity>Development of tools to help the scientists to manage and mind their data.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Director of Bioinformatics</doac:title>
<doac:location>Integragen SA</doac:location>
<doac:date-starts>2006-11-01</doac:date-starts>
<doac:date-ends>2008-09-01</doac:date-ends>
<doac:activity>Scientific Developer (JAVA/C++). In charge of database management, software development, technical & scientific survey.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Scientific Developer</doac:title>
<doac:location>Integragen</doac:location>
<doac:date-starts>2001-02-01</doac:date-starts>
<doac:date-ends>2006-01-01</doac:date-ends>
<doac:activity>Responsible for the design and implementation of a software environment for information visualization of microarray CGH/GHip and public databases datas. Tools in C++ and JAVA for handling and browsing genomic datas. • PMID: 16027742 Philippi A, Roschmann E, Tores F, Lindenbaum P, Benajou A, Germain-Leclerc L, Marcaillou C, Fontaine K, Vanpeene M, Roy S, Maillard S, Decaulne V, Saraiva JP, Brooks P, Rousseau F, Hager J. Haplotypes in the gene encoding protein kinase c-beta (PRKCB1) on chromosome 16 are associated with autism. Mol Psychiatry. 2005 Jul 19</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Scientific Developer</doac:title>
<doac:location>National Center of Genotyping</doac:location>
<doac:date-starts>2000-03-01</doac:date-starts>
<doac:date-ends>2001-03-01</doac:date-ends>
<doac:activity>In charge of creating a software used to design genotyping by mass spectrometry in multiplex condition (GOOD-Assay). Database management.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Université Paris Sud (Paris XI)</foaf:organization>
<doac:title>PhD</doac:title>
<doac:date-starts>1996-01-01</doac:date-starts>
<doac:date-ends>2000-12-31</doac:date-ends>
<doac:subject>Studied protein-protein interactions between ROTAVIRUS and the host cell. Wrote a tool called CloneIt selecting restriction enzymes for subcloning strategies. • PMID:15047801 Vitour D, Lindenbaum P, Vende P, Becker MM, Poncet D. RoXaN, a novel cellular protein containing TPR, LD, and zinc finger motifs, forms a ternary complex with eukaryotic initiation factor 4G and rotavirus NSP3. J Virol. 2004 Apr;78(8):3851-62. • PMID:9682060 Lindenbaum P. CloneIt: finding cloning strategies, in-frame deletions and frameshifts. Bioinformatics. 1998 Jun;14(5):465-6. • PMID:8985320 Poncet D, Lindenbaum P, L'Haridon R, Cohen J. In vivo and in vitro phosphorylation of rotavirus NSP5 correlates with its localization in viroplasms. J Virol. 1997 Jan;71(1):34-41.</doac:subject>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Université Paris Sud (Paris XI)</foaf:organization>
<doac:title>DEA</doac:title>
<doac:date-starts>1995-01-01</doac:date-starts>
<doac:date-ends>1996-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Université Paris Sud (Paris XI)</foaf:organization>
<doac:title>Maitrise</doac:title>
<doac:date-starts>1993-01-01</doac:date-starts>
<doac:date-ends>1994-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://plindenbaum.blogspot.com"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://friendfeed.com/yokofakun">
<foaf:accountName>yokofakun</foaf:accountName>
<foaf:accountServiceHomepage rdf:resource="http://friendfeed.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://twitter.com/yokofakun">
<foaf:accountName>yokofakun</foaf:accountName>
<foaf:accountServiceHomepage rdf:resource="http://twitter.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=1510707">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=41305706">
<foaf:name>Matthias Samwald</foaf:name>
<foaf:givenname>Matthias</foaf:givenname>
<foaf:family_name>Samwald</foaf:family_name>
<doac:summary>Postdoctoral researcher at DERI Galway (Ireland) and the Konrad Lorenz Institute (Austria)</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Austria, AT</dc:title>
<geo:long>13.3333333</geo:long>
<geo:lat>47.3333333</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://samwald.info"/>
<foaf:homepage rdf:resource="http://deri.ie"/>
<foaf:homepage rdf:resource="http://kli.ac.at"/>
<doac:experience>
<doac:Experience>
<doac:title>Postdoctoral researcher</doac:title>
<doac:location>Konrad Lorenz Institute for Evolution and Cognition Research</doac:location>
<doac:date-starts>2008-12-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Postdoctoral researcher</doac:title>
<doac:location>DERI</doac:location>
<doac:date-starts>2007-10-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Project Manager</doac:title>
<doac:location>Semantic Web Company</doac:location>
<doac:date-starts>2008-01-01</doac:date-starts>
<doac:date-ends>2008-12-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Consultant</doac:title>
<doac:location>Yale University School of Medicine</doac:location>
<doac:date-starts>2007-07-01</doac:date-starts>
<doac:date-ends>2008-04-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>PhD student</doac:title>
<doac:location>Yale University School of Medicine</doac:location>
<doac:date-starts>2007</doac:date-starts>
<doac:date-ends>2007</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Developer</doac:title>
<doac:location>Creative Commons</doac:location>
<doac:date-starts>2007-06-01</doac:date-starts>
<doac:date-ends>2007-09-01</doac:date-ends>
<doac:activity>Project for Science Commons, funded by Google ('Summer of Code').</doac:activity>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Medizinische Universität Wien</foaf:organization>
<doac:title>Dr. rer. nat.</doac:title>
<doac:date-starts>2005-01-01</doac:date-starts>
<doac:date-ends>2008-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Universität Wien</foaf:organization>
<doac:title>MSc</doac:title>
<doac:date-starts>2000-01-01</doac:date-starts>
<doac:date-ends>2005-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://samwald.info"/>
<foaf:homepage rdf:resource="http://deri.ie"/>
<foaf:homepage rdf:resource="http://kli.ac.at"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=41305706">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=13686406">
<foaf:name>Mitsuteru Nakao</foaf:name>
<foaf:givenname>Mitsuteru</foaf:givenname>
<foaf:family_name>Nakao</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/3/000/012/09b/360cf38.jpg">
<dc:title>Mitsuteru Nakao</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Project Researcher at DBCLS</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:experience>
<doac:Experience>
<doac:title>Project Researcher</doac:title>
<doac:location>DBCLS</doac:location>
<doac:date-starts>2009-04-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Affiliated Researcher</doac:title>
<doac:location>Kazusa DNA Research Institute</doac:location>
<doac:date-starts>2009-04-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Staff</doac:title>
<doac:location>Creative Commons Japan</doac:location>
<doac:date-starts>2008-11-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Affiliated Researcher</doac:title>
<doac:location>National Institute of Advanced Industrial Science and Technology (AIST)</doac:location>
<doac:date-starts>2006-04-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>BioRuby project developer</doac:title>
<doac:location>Open Bioinformatics Foundation</doac:location>
<doac:date-starts>2001</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Postdoc researcher</doac:title>
<doac:location>Kazusa DNA Research Institute</doac:location>
<doac:date-starts>2006-04-01</doac:date-starts>
<doac:date-ends>2009-03-01</doac:date-ends>
<doac:activity>Plant and microbe genomics. Developing web services (CyanoBase, RhizoBase, KazusaAnnotation, KazusaNavigation, KazusaWiki and NandemoGFF) to distribute and analyze genome and gene annotations.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Postdoc</doac:title>
<doac:location>National Institute of Advanced Industrial Science and Technology (AIST)</doac:location>
<doac:date-starts>2004-04-01</doac:date-starts>
<doac:date-ends>2006-03-01</doac:date-ends>
<doac:activity>Developed a source code search server for bioinformatics, b-src.cbrc.jp. Investigated a classification of a human alternative spliced protein variants.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Researcher</doac:title>
<doac:location>The Institute of Medical Science, The University of Tokyo</doac:location>
<doac:date-starts>2002-04-01</doac:date-starts>
<doac:date-ends>2004-03-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Kyoto University</foaf:organization>
<doac:title>Ph.D</doac:title>
<doac:date-starts>1996-01-01</doac:date-starts>
<doac:date-ends>2000-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Hokkaido University</foaf:organization>
<doac:title>BS</doac:title>
<doac:date-starts>1992-01-01</doac:date-starts>
<doac:date-ends>1996-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=13686406">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=34770184">
<foaf:name>Paul Gordon</foaf:name>
<foaf:givenname>Paul</foaf:givenname>
<foaf:family_name>Gordon</foaf:family_name>
<doac:summary>Research Associate/PhD Candidate at University of Calgary</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>South Calgary, CA</dc:title>
<geo:long>-114.103375459</geo:long>
<geo:lat>51.04177898</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:skill>discovery</doac:skill>
<doac:skill>Motif</doac:skill>
<doac:skill>analysis</doac:skill>
<doac:skill>Microarray</doac:skill>
<doac:skill>Semantics/Ontologies</doac:skill>
<doac:skill>Design</doac:skill>
<doac:skill>Interface</doac:skill>
<doac:skill>User</doac:skill>
<doac:skill>Services</doac:skill>
<doac:skill>Web</doac:skill>
<doac:skill>development</doac:skill>
<doac:skill>Algorithm</doac:skill>
<doac:skill>analysis</doac:skill>
<doac:skill>Genome</doac:skill>
<doac:skill>Bioinformatics</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>Research Associate/PhD candidate</doac:title>
<doac:location>University of Calgary</doac:location>
</doac:Experience>
</doac:experience>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=34770184">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=16314219">
<foaf:name>Raoul Bonnal</foaf:name>
<foaf:givenname>Raoul</foaf:givenname>
<foaf:family_name>Bonnal</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/3/000/017/08b/094f8d0.jpg">
<dc:title>Raoul Bonnal</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>at Fondazione INGM, Integrative Biology Program</doac:summary>
<doac:skill>PostgreSQL.</doac:skill>
<doac:skill>)</doac:skill>
<doac:skill>X</doac:skill>
<doac:skill>OS</doac:skill>
<doac:skill>(Linux</doac:skill>
<doac:skill>Amin</doac:skill>
<doac:skill>Java.</doac:skill>
<doac:skill>C</doac:skill>
<doac:skill>Rails)</doac:skill>
<doac:skill>(BioRuby</doac:skill>
<doac:skill>Ruby</doac:skill>
<doac:skill>Devel:</doac:skill>
<doac:skill>Solving.</doac:skill>
<doac:skill>Problem</doac:skill>
<doac:skill>(454)</doac:skill>
<doac:skill>data</doac:skill>
<doac:skill>Sequencing</doac:skill>
<doac:skill>DNA</doac:skill>
<doac:skill>High-throughput</doac:skill>
<doac:skill>Analysis</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>Bioinformatics Research Scientist</doac:title>
<doac:location>Fondazione Istituto Nazionale Genetica Molecolare -INGM-</doac:location>
<doac:date-starts>2009-02-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Bioinfo</doac:title>
<doac:location>BioHackathon</doac:location>
<doac:date-starts>2009</doac:date-starts>
<doac:date-ends>2009</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Bioinformatician</doac:title>
<doac:location>Institute for Biomedical Technologies, Italian National Research Council</doac:location>
<doac:date-starts>2003-03-01</doac:date-starts>
<doac:date-ends>2009-01-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>ITB CNR collaboration with</doac:title>
<doac:location>454 Life Sciences</doac:location>
<doac:date-starts>2005</doac:date-starts>
<doac:date-ends>2005</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Università degli Studi di Milano-Bicocca</foaf:organization>
<doac:title>Bachelor</doac:title>
<doac:date-starts>1998-01-01</doac:date-starts>
<doac:date-ends>2002-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=16314219">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=13051716">
<foaf:name>Rutger Vos</foaf:name>
<foaf:givenname>Rutger</foaf:givenname>
<foaf:family_name>Vos</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/1/000/015/1b4/25a8ae4.jpg">
<dc:title>Rutger Vos</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Marie Curie fellow at the University of Reading and bioinformatics consultant</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Reading, GB</dc:title>
<geo:long>-1.0</geo:long>
<geo:lat>51.4333333</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://www.ohloh.net/accounts/6958"/>
<foaf:homepage rdf:resource="http://www.nexml.org"/>
<foaf:homepage rdf:resource="http://rutgervos.blogspot.com"/>
<doac:skill>German</doac:skill>
<doac:skill>Dutch</doac:skill>
<doac:skill>English</doac:skill>
<doac:skill>development</doac:skill>
<doac:skill>web</doac:skill>
<doac:skill>sql</doac:skill>
<doac:skill>c</doac:skill>
<doac:skill>xml</doac:skill>
<doac:skill>java</doac:skill>
<doac:skill>corba</doac:skill>
<doac:skill>perl</doac:skill>
<doac:skill>patterns</doac:skill>
<doac:skill>design</doac:skill>
<doac:skill>middleware</doac:skill>
<doac:skill>engineering</doac:skill>
<doac:skill>software</doac:skill>
<doac:skill>bioinformatics</doac:skill>
<doac:skill>phyloinformatics</doac:skill>
<doac:skill>phylogenetics</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>Marie Curie Fellow</doac:title>
<doac:location>University of Reading</doac:location>
<doac:date-starts>2009-11-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Bioinformatics consultant</doac:title>
<doac:location>University of Pennsylvania</doac:location>
<doac:date-starts>2008-09-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Software Engineer</doac:title>
<doac:location>BioPerl Project</doac:location>
<doac:date-starts>2007</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Computational biologist</doac:title>
<doac:location>the international scientific community</doac:location>
<doac:date-starts>2001-01-01</doac:date-starts>
<doac:activity>This position is a "catch all" position to describe contacts through conferences, work-meetings, public lectures and various collaborations. LinkedIn is too focused on business-to-business contacts to be entirely applicable to scientists in academia, in my opinion.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Postdoctoral research fellow</doac:title>
<doac:location>University of British Columbia</doac:location>
<doac:date-starts>2006-05-01</doac:date-starts>
<doac:date-ends>2009-09-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Software Engineer</doac:title>
<doac:location>CyberInfrastructure for Phylogenetic Research</doac:location>
<doac:date-starts>2003</doac:date-starts>
<doac:date-ends>2009-09-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Developer</doac:title>
<doac:location>BioMedia</doac:location>
<doac:date-starts>2000</doac:date-starts>
<doac:date-ends>2000</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Simon Fraser University</foaf:organization>
<doac:title>PhD.</doac:title>
<doac:date-starts>2001-01-01</doac:date-starts>
<doac:date-ends>2006-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Universiteit van Amsterdam</foaf:organization>
<doac:title>MSc.</doac:title>
<doac:date-starts>1994-01-01</doac:date-starts>
<doac:date-ends>2000-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Het Wageningsch Lyceum</foaf:organization>
<doac:title/>
<doac:date-starts>1988-01-01</doac:date-starts>
<doac:date-ends>1994-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://www.ohloh.net/accounts/6958"/>
<foaf:homepage rdf:resource="http://www.nexml.org"/>
<foaf:homepage rdf:resource="http://rutgervos.blogspot.com"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=13051716">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=40227171">
<foaf:name>Shuichi Kawashima</foaf:name>
<foaf:givenname>Shuichi</foaf:givenname>
<foaf:family_name>Kawashima</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/2/000/036/2c7/2512d10.jpg">
<dc:title>Shuichi Kawashima</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Research associate at University of Tokyo</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://www.genome.jp/kegg/soap/"/>
<foaf:homepage rdf:resource="http://www.genome.jp/aaindex/"/>
<foaf:homepage rdf:resource="http://kanehisa.hgc.jp/"/>
<doac:experience>
<doac:Experience>
<doac:title>Research associate</doac:title>
<doac:location>Institute of Medical Science, University of Tokyo</doac:location>
<doac:date-starts>2004-09-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Instructor</doac:title>
<doac:location>Institute for Chemical Research, Kyoto University</doac:location>
<doac:date-starts>1999-08-01</doac:date-starts>
<doac:date-ends>2004-08-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Kyoto University</foaf:organization>
<doac:title/>
<doac:date-starts>1995-01-01</doac:date-starts>
<doac:date-ends>1999-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Kansai University</foaf:organization>
<doac:title/>
<doac:date-starts>1990-01-01</doac:date-starts>
<doac:date-ends>1995-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://www.genome.jp/kegg/soap/"/>
<foaf:homepage rdf:resource="http://www.genome.jp/aaindex/"/>
<foaf:homepage rdf:resource="http://kanehisa.hgc.jp/"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=40227171">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=12409171">
<foaf:name>Thomas Kappler</foaf:name>
<foaf:givenname>Thomas</foaf:givenname>
<foaf:family_name>Kappler</foaf:family_name>
<doac:summary>Bioinformatics Software Developer at Swiss Institute of Bioinformatics</doac:summary>
<foaf:homepage rdf:resource="http://jugglingbits.wordpress.com/"/>
<foaf:homepage rdf:resource="http://jugglingbits.wordpress.com/about"/>
<doac:experience>
<doac:Experience>
<doac:title>Bioinformatics Software Developer</doac:title>
<doac:location>Swiss Institute of Bioinformatics</doac:location>
<doac:date-starts>2008-05-01</doac:date-starts>
<doac:activity>I develop and maintain several web-based applications, some of them in-house database curation tools. Along with the applications, I'm involved in maintaining and further developing the data models, including relational schemas as well as an XML and an RDF/OWL distribution. I'm in constant exchange with biologists and bioinformaticians at other sites.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Software Architect and Developer</doac:title>
<doac:location>University of Heidelberg</doac:location>
<doac:date-starts>2007-10-01</doac:date-starts>
<doac:date-ends>2008-04-01</doac:date-ends>
<doac:activity>Working as independent developer, I created a web-based application for the creation and publishing of a dictionary/thesaurus, for the DEAF group at University of Heidelberg, who create a dictionary of medieval French and are one of the most renowned groups in this field internationally. After extensive requirements engineering, I took over the lead as sole full-time developer. The task included designing the domain model and storage architecture as Java POJOs with Hibernate ORM, and developing a web application using Apache Wicket. The implementation includes different user roles and authentication, versioning of data, and a complex UI with AJAX. I worked with two student assistant programmers, assigning tasks and supervising them. The application will accelerate the process of dictionary creation, which involves a large number of sources and is currently done on paper, and will allow electronic publishing of completed articles.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Assistant developer and researcher</doac:title>
<doac:location>University of Karlsruhe</doac:location>
<doac:date-starts>2005-07-01</doac:date-starts>
<doac:date-ends>2006-07-01</doac:date-ends>
<doac:activity>Developer in two text mining projects with Dr. Rene Witte. For an architecture project (“Durm”), I designed an XML schema for given historical documents and developed a conversion from a non-standard textual format to XML and an automatic upload to a wiki, in Python. For a project about text mining biomedical publications (“Mutation Miner”), I implemented several components for the GATE text analysis framework in Java. I developed a tool in Python for inserting large plain text data sets from public databases into SQL databases and populating an OWL ontology from the data. The GATE components use this ontology for entity and relation discovery, including the grounding of discovered entities in reference databases. The system enables protein engineers to annotate 3D protein models with data extracted from biomedical literature, whose review would be impossible due to the amount of publications. These projects resulted in three publications I co-authored.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Software and database developer</doac:title>
<doac:location>Zentrum für Kunst und Medientechnologie (ZKM)</doac:location>
<doac:date-starts>2004-02-01</doac:date-starts>
<doac:date-ends>2004-08-01</doac:date-ends>
<doac:activity>Developed and modified web-based software in PHP. Designed an SQL database and implemented it including final deployment. Implemented a conversion tool from Filemaker to the new database.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Indian Institute of Technology, Delhi</foaf:organization>
<doac:title/>
<doac:date-starts>2007-01-01</doac:date-starts>
<doac:date-ends>2007-12-31</doac:date-ends>
<doac:subject>I wrote my Master's thesis at IIT under guidance of Prof. P. Jalote, in an exchange program by the German Academic Exchange Service (DAAD), from February to July 2007.</doac:subject>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Universität Karlsruhe (TH)</foaf:organization>
<doac:title>Diplom</doac:title>
<doac:date-starts>2001-01-01</doac:date-starts>
<doac:date-ends>2007-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://jugglingbits.wordpress.com/"/>
<foaf:homepage rdf:resource="http://jugglingbits.wordpress.com/about"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=12409171">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=4889459">
<foaf:name>Tore Eriksson</foaf:name>
<foaf:givenname>Tore</foaf:givenname>
<foaf:family_name>Eriksson</foaf:family_name>
<doac:summary>Research Scientist at Taisho Pharmaceuticals</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:experience>
<doac:Experience>
<doac:title>Research Leader</doac:title>
<doac:location>Taisho Pharmaceuticals</doac:location>
<doac:date-starts>2000-02-01</doac:date-starts>
</doac:Experience>
</doac:experience>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=4889459">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=21783495">
<foaf:name>Toshiaki Katayama</foaf:name>
<foaf:givenname>Toshiaki</foaf:givenname>
<foaf:family_name>Katayama</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/2/000/020/02a/1ce5192.jpg">
<dc:title>Toshiaki Katayama</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Assistant Professor at University of Tokyo</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://bioruby.org/"/>
<foaf:homepage rdf:resource="http://kumamushi.org/"/>
<foaf:homepage rdf:resource="http://kanehisa.hgc.jp/"/>
<doac:skill>Rails.</doac:skill>
<doac:skill>and</doac:skill>
<doac:skill>Ruby</doac:skill>
<doac:skill>AJAX</doac:skill>
<doac:skill>CSS</doac:skill>
<doac:skill>HTML</doac:skill>
<doac:skill>XML</doac:skill>
<doac:skill>REST</doac:skill>
<doac:skill>SOAP/WSDL</doac:skill>
<doac:skill>HTTP</doac:skill>
<doac:skill>RDB</doac:skill>
<doac:skill>SGE</doac:skill>
<doac:skill>IRIX</doac:skill>
<doac:skill>Solaris</doac:skill>
<doac:skill>X</doac:skill>
<doac:skill>OS</doac:skill>
<doac:skill>Linux</doac:skill>
<doac:skill>HPC</doac:skill>
<doac:skill>DAS</doac:skill>
<doac:skill>KEGG</doac:skill>
<doac:skill>Bioinformatics</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>Assistant Professor</doac:title>
<doac:location>University of Tokyo</doac:location>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>BioRuby project leader</doac:title>
<doac:location>Open Bioinformatics Foundation</doac:location>
<doac:date-starts>2001</doac:date-starts>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Student, Technical staff</doac:title>
<doac:location>Kyoto University</doac:location>
<doac:date-starts>1992-04-01</doac:date-starts>
<doac:date-ends>2003-08-01</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Kyoto University</foaf:organization>
<doac:title/>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://bioruby.org/"/>
<foaf:homepage rdf:resource="http://kumamushi.org/"/>
<foaf:homepage rdf:resource="http://kanehisa.hgc.jp/"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=21783495">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=12738919">
<foaf:name>David Withers</foaf:name>
<foaf:givenname>David</foaf:givenname>
<foaf:family_name>Withers</foaf:family_name>
<doac:summary>at The University of British Columbia</doac:summary>
<doac:experience>
<doac:Experience>
<doac:title>Senior Programmer / Analyst</doac:title>
<doac:location>University of British Columbia</doac:location>
<doac:date-starts>2009-06-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Software Engineer</doac:title>
<doac:location>University of Manchester</doac:location>
<doac:date-starts>2006-02-01</doac:date-starts>
<doac:date-ends>2009-05-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Research Associate</doac:title>
<doac:location>University of Manchester</doac:location>
<doac:date-starts>1999-10-01</doac:date-starts>
<doac:date-ends>2006-01-01</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>The University of Manchester</foaf:organization>
<doac:title>BSc</doac:title>
<doac:date-starts>1995-01-01</doac:date-starts>
<doac:date-ends>1998-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>The University of Glamorgan</foaf:organization>
<doac:title/>
<doac:date-starts>1993-01-01</doac:date-starts>
<doac:date-ends>1995-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=12738919">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=35979245">
<foaf:name>Hong-Woo Chun</foaf:name>
<foaf:givenname>Hong-Woo</foaf:givenname>
<foaf:family_name>Chun</foaf:family_name>
<doac:summary>Project Researcher at Database Center for Life Science</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:experience>
<doac:Experience>
<doac:title>Project Researcher</doac:title>
<doac:location>Database Center for Life Science</doac:location>
</doac:Experience>
</doac:experience>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=35979245">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=37942607">
<foaf:name>Yasunori Yamamoto</foaf:name>
<foaf:givenname>Yasunori</foaf:givenname>
<foaf:family_name>Yamamoto</foaf:family_name>
<doac:summary>Researcher at Database Center for Life Science</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:experience>
<doac:Experience>
<doac:title>a part-time teacher</doac:title>
<doac:location>University of Tokyo</doac:location>
<doac:date-starts>2008-04-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Researcher</doac:title>
<doac:location>Database Center for Life Science</doac:location>
<doac:date-starts>2007-06-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Researcher</doac:title>
<doac:location>University of Tokyo</doac:location>
<doac:date-starts>2005</doac:date-starts>
<doac:date-ends>2009</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>The University of Tokyo</foaf:organization>
<doac:title>Ph.D</doac:title>
<doac:date-starts>2002-01-01</doac:date-starts>
<doac:date-ends>2005-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=37942607">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=4631981">
<foaf:name> Mark Wilkinson </foaf:name>
<foaf:givenname>Mark</foaf:givenname>
<foaf:family_name>Wilkinson</foaf:family_name>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=4631981">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=13946714">
<foaf:name>Arek Kasprzyk</foaf:name>
<foaf:givenname>Arek</foaf:givenname>
<foaf:family_name>Kasprzyk</foaf:family_name>
<doac:summary>Director, Bioinformatics Operations at OiCR Toronto</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Canada, CA</dc:title>
<geo:long>-96.0</geo:long>
<geo:lat>60.0</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:experience>
<doac:Experience>
<doac:title>Director, Bioinformatics Operations and Principal Investigator. BioMart project leader</doac:title>
<doac:location>Ontario Institute for Cancer Research (OICR)</doac:location>
<doac:date-starts>2008-04-01</doac:date-starts>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Group Leader</doac:title>
<doac:location>European Bioinformatics Institute (EBI)</doac:location>
<doac:date-starts>1999</doac:date-starts>
<doac:date-ends>2008</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>visitor</doac:title>
<doac:location>JBiRC</doac:location>
<doac:date-starts>2003</doac:date-starts>
<doac:date-ends>2004</doac:date-ends>
</doac:Experience>
</doac:experience>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=13946714">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=14071207">
<foaf:name>Kazuharu Arakawa</foaf:name>
<foaf:givenname>Kazuharu</foaf:givenname>
<foaf:family_name>Arakawa</foaf:family_name>
<doac:summary>Assistant Professor at Keio University</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://web.sfc.keio.ac.jp/~gaou/"/>
<doac:experience>
<doac:Experience>
<doac:title>Assistant Professor</doac:title>
<doac:location>Keio University</doac:location>
<doac:date-starts>2009-04-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>attendee</doac:title>
<doac:location>BioHackathon</doac:location>
<doac:date-starts>2008</doac:date-starts>
<doac:date-ends>2010</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Research Associate</doac:title>
<doac:location>Keio University</doac:location>
<doac:date-starts>2007-04-01</doac:date-starts>
<doac:date-ends>2009-03-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Lecturer</doac:title>
<doac:location>Keio University</doac:location>
<doac:date-starts>2005-09-01</doac:date-starts>
<doac:date-ends>2007-03-01</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Keio University</foaf:organization>
<doac:title/>
<doac:date-starts>1998-01-01</doac:date-starts>
<doac:date-ends>2006-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://web.sfc.keio.ac.jp/~gaou/"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=14071207">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=18946009">
<foaf:name>Keiichiro Ono</foaf:name>
<foaf:givenname>Keiichiro</foaf:givenname>
<foaf:family_name>Ono</foaf:family_name>
<doac:summary>Research Associate / Programmer Analyst at UCSD</doac:summary>
<foaf:homepage rdf:resource="http://chianti.ucsd.edu/kono/"/>
<foaf:homepage rdf:resource="http://d.hatena.ne.jp/keiono"/>
<foaf:homepage rdf:resource="http://cytoscape.seesaa.net/"/>
<doac:experience>
<doac:Experience>
<doac:title>Research Associate</doac:title>
<doac:location>UCSD</doac:location>
<doac:date-starts>2005</doac:date-starts>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Research Assistant</doac:title>
<doac:location>University of Southern California</doac:location>
<doac:date-starts>2002</doac:date-starts>
<doac:date-ends>2003</doac:date-ends>
<doac:activity>Worked as a bioinformatics programmer at Gene Therapy Lab.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Research Assistant</doac:title>
<doac:location>UC Irvine</doac:location>
<doac:date-starts>1999</doac:date-starts>
<doac:date-ends>2001</doac:date-ends>
<doac:activity>Worked as bioinformatics programmer at Dr. P. Baldi's Lab and Dr. Luecke Lab.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>University of California, Irvine</foaf:organization>
<doac:title>BS</doac:title>
<doac:subject>Focused on AI and Bioinformatics.</doac:subject>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>University of Southern California</foaf:organization>
<doac:title>MS</doac:title>
<doac:subject>After Computational Molecular Biology track, spend one extra year to study computer science courses at School of Engineering.</doac:subject>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://chianti.ucsd.edu/kono/"/>
<foaf:homepage rdf:resource="http://d.hatena.ne.jp/keiono"/>
<foaf:homepage rdf:resource="http://cytoscape.seesaa.net/"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=18946009">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=24539252">
<foaf:name>Anna-Lena Lamprecht</foaf:name>
<foaf:givenname>Anna-Lena</foaf:givenname>
<foaf:family_name>Lamprecht</foaf:family_name>
<doac:summary>PhD student at Dortmund University of Technology</doac:summary>
<foaf:homepage rdf:resource="http://ls5-www.cs.uni-dortmund.de:8050/"/>
<doac:experience>
<doac:Experience>
<doac:title>PhD student</doac:title>
<doac:location>Dortmund University of Technology</doac:location>
<doac:date-starts>2007-09-01</doac:date-starts>
<doac:activity>Field: process management for bioinformatics</doac:activity>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Georg-August-Universität Göttingen</foaf:organization>
<doac:title/>
<doac:date-starts>2002-01-01</doac:date-starts>
<doac:date-ends>2007-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://ls5-www.cs.uni-dortmund.de:8050/"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=24539252">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=9705742">
<foaf:name> Brad Chapman </foaf:name>
<foaf:givenname>Brad</foaf:givenname>
<foaf:family_name>Chapman</foaf:family_name>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=9705742">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=11849955">
<foaf:name>Erick Antezana</foaf:name>
<foaf:givenname>Erick</foaf:givenname>
<foaf:family_name>Antezana</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/1/000/003/12f/05b1a5c.jpg">
<dc:title>Erick Antezana</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Scientist at Bayer CropScience</doac:summary>
<foaf:homepage rdf:resource="http://www.psb.ugent.be/~erant"/>
<foaf:homepage rdf:resource="http://www.cellcycleontology.org"/>
<foaf:homepage rdf:resource="http://www.semantic-systems-biology.org"/>
<doac:skill>representation.</doac:skill>
<doac:skill>knowledge</doac:skill>
<doac:skill>biological</doac:skill>
<doac:skill>systems</doac:skill>
<doac:skill>operating</doac:skill>
<doac:skill>engineering</doac:skill>
<doac:skill>Ontology</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>Scientist</doac:title>
<doac:location>Bayer CropScience</doac:location>
<doac:date-starts>2008-11-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>PhD Student</doac:title>
<doac:location>VIB</doac:location>
<doac:date-starts>2005-04-01</doac:date-starts>
<doac:date-ends>2008-10-01</doac:date-ends>
<doac:activity>Working on Bio-ontologies to support Semantic Systems Biology: http://www.cellcycleontology.org http://www.semantic-systems-biology.org</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Visiting fellow</doac:title>
<doac:location>University of Manchester</doac:location>
<doac:date-starts>2007-10-01</doac:date-starts>
<doac:date-ends>2008-02-01</doac:date-ends>
<doac:activity>Bio-Health Informatics Group. Dr. Robert Stevens</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Scientific programmer</doac:title>
<doac:location>Université Libre de Bruxelles</doac:location>
<doac:date-starts>2003-01-01</doac:date-starts>
<doac:date-ends>2004-12-01</doac:date-ends>
<doac:activity>http://www.amaze.ulb.ac.be/</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Researcher</doac:title>
<doac:location>Universidad Catolica Boliviana</doac:location>
<doac:date-starts>2000-01-01</doac:date-starts>
<doac:date-ends>2001-10-01</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>System Administrator</doac:title>
<doac:location>Universidad Catolica Boliviana</doac:location>
<doac:date-starts>1998-02-01</doac:date-starts>
<doac:date-ends>1999-12-01</doac:date-ends>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Universiteit Gent</foaf:organization>
<doac:title>PhD</doac:title>
<doac:date-starts>2005-01-01</doac:date-starts>
<doac:date-ends>2009-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>University of Geneva</foaf:organization>
<doac:title>MSc</doac:title>
<doac:date-starts>2001-01-01</doac:date-starts>
<doac:date-ends>2002-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Universidad Católica Boliviana</foaf:organization>
<doac:title/>
<doac:date-starts>1994-01-01</doac:date-starts>
<doac:date-ends>1999-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://www.psb.ugent.be/~erant"/>
<foaf:homepage rdf:resource="http://www.cellcycleontology.org"/>
<foaf:homepage rdf:resource="http://www.semantic-systems-biology.org"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=11849955">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=6070868">
<foaf:name>Hammad Afzal</foaf:name>
<foaf:givenname>Hammad</foaf:givenname>
<foaf:family_name>Afzal</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/2/000/029/27a/2671deb.jpg">
<dc:title>Hammad Afzal</dc:title>
</foaf:Image>
</foaf:depiction>
<foaf:based_near>
<geo:Point>
<dc:title>Manchester, GB</dc:title>
<geo:long>-2.23743438720703</geo:long>
<geo:lat>53.4809464283615</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=6070868">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=63377764">
<foaf:name>Keun-Joon Park</foaf:name>
<foaf:givenname>Keun-Joon</foaf:givenname>
<foaf:family_name>Park</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/3/000/048/20a/0003ad9.jpg">
<dc:title>Keun-Joon Park</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Principal Research Scientist at Korea National Institute of Health</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>South Korea, KR</dc:title>
<geo:long>127.5</geo:long>
<geo:lat>37.0</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:experience>
<doac:Experience>
<doac:title>Principal Research Scientist</doac:title>
<doac:location>Korea National Institute of Health</doac:location>
<doac:date-starts>2006-04-01</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Researcher</doac:title>
<doac:location>The University of Tokyo</doac:location>
<doac:date-starts>2005-04-01</doac:date-starts>
<doac:date-ends>2006-03-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Researcher</doac:title>
<doac:location>AIST</doac:location>
<doac:date-starts>2003-04-01</doac:date-starts>
<doac:date-ends>2005-03-01</doac:date-ends>
<doac:activity>CBRC (Computational Biology Research Center)</doac:activity>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Kyoto University</foaf:organization>
<doac:title>Ph. D.</doac:title>
<doac:date-starts>1993-01-01</doac:date-starts>
<doac:date-ends>2003-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=63377764">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=65153053">
<foaf:name>Koji Nagao</foaf:name>
<foaf:givenname>Koji</foaf:givenname>
<foaf:family_name>Nagao</foaf:family_name>
<doac:summary>Assistant Professor at Hokkaido University</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:skill>language</doac:skill>
<doac:skill>R</doac:skill>
<doac:skill>and</doac:skill>
<doac:skill>Ruby</doac:skill>
<doac:skill>X</doac:skill>
<doac:skill>OS</doac:skill>
<doac:skill>Bioinformatics</doac:skill>
<doac:skill>biology</doac:skill>
<doac:skill>Cell</doac:skill>
<doac:skill>biology</doac:skill>
<doac:skill>Molecular</doac:skill>
<doac:experience>
<doac:Experience>
<doac:title>Assistant Professor</doac:title>
<doac:location>Hokkaido University</doac:location>
<doac:date-starts>2009-08-01</doac:date-starts>
<doac:activity>Study on chromosome organization in human cells Bioinformatics for Mass Spectrometry and Next Generation Sequencing</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Postdoc researcher</doac:title>
<doac:location>Okinawa Institute of Science and Technology</doac:location>
<doac:date-starts>2004-04-01</doac:date-starts>
<doac:date-ends>2009-07-01</doac:date-ends>
<doac:activity>Study on switching between cellular proliferation and quiescence (non-dividing state) Quantitative proteomics using mass spectrometry</doac:activity>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Kyoto University</foaf:organization>
<doac:title>Ph.D</doac:title>
<doac:date-starts>1992-01-01</doac:date-starts>
<doac:date-ends>2004-12-31</doac:date-ends>
<doac:subject>Study on chromosome segregation and maintenance using fission yeast as a model organism Completed BS and MS degrees in Biology Research Fellow of Japan Society for the Promotion of Science (April 1998 - March 2001)</doac:subject>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=65153053">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=40273227">
<foaf:name>Kozo Nishida</foaf:name>
<foaf:givenname>Kozo</foaf:givenname>
<foaf:family_name>Nishida</foaf:family_name>
<doac:summary>Student at Nara Sentan Kagakugijyutsu Daigakuin Daigaku</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:education>
<doac:Education>
<foaf:organization>Nara Institute of Science and Technology</foaf:organization>
<doac:title/>
<doac:date-starts>2008-01-01</doac:date-starts>
<doac:date-ends>2011-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=40273227">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=61573617">
<foaf:name>Oouchida Kenta</foaf:name>
<foaf:givenname>Oouchida</foaf:givenname>
<foaf:family_name>Kenta</foaf:family_name>
<doac:summary>Project Senior Technical Support Specialist at Database Center for Life Science</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://researchmap.jp/oouchida"/>
<doac:experience>
<doac:Experience>
<doac:title>Project Senior Technical Support Specialist</doac:title>
<doac:location>Database Center for Life Science</doac:location>
</doac:Experience>
</doac:experience>
<foaf:homepage rdf:resource="http://researchmap.jp/oouchida"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=61573617">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=2302145">
<foaf:name> Pjotr Prins </foaf:name>
<foaf:givenname>Pjotr</foaf:givenname>
<foaf:family_name>Prins</foaf:family_name>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=2302145">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=46763330">
<foaf:name>Richard Smith</foaf:name>
<foaf:givenname>Richard</foaf:givenname>
<foaf:family_name>Smith</foaf:family_name>
<doac:summary>Lead Developer, InterMine at University of Cambridge</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Cambridge, GB</dc:title>
<geo:long>0.1166667</geo:long>
<geo:lat>52.2</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://www.intermine.org"/>
<foaf:homepage rdf:resource="http://www.flymine.org"/>
<foaf:homepage rdf:resource="http://www.modmine.org"/>
<doac:experience>
<doac:Experience>
<doac:title>Lead Developer, InterMine</doac:title>
<doac:location>University of Cambridge</doac:location>
<doac:date-starts>2002</doac:date-starts>
<doac:activity/>
</doac:Experience>
</doac:experience>
<foaf:homepage rdf:resource="http://www.intermine.org"/>
<foaf:homepage rdf:resource="http://www.flymine.org"/>
<foaf:homepage rdf:resource="http://www.modmine.org"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=46763330">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=29841918">
<foaf:name>Soichi Ogishima</foaf:name>
<foaf:givenname>Soichi</foaf:givenname>
<foaf:family_name>Ogishima</foaf:family_name>
<doac:summary>Assistant Professor at Tokyo Medical and Dental University</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:experience>
<doac:Experience>
<doac:title>Assistant Professor</doac:title>
<doac:location>Tokyo Medical and Dental University</doac:location>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Tokyo Medical and Dental University</foaf:organization>
<doac:title>Ph.D</doac:title>
<doac:subject/>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>University of Tokyo</foaf:organization>
<doac:title/>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=29841918">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=27869976">
<foaf:name>Taro L. Saito</foaf:name>
<foaf:givenname>Taro L.</foaf:givenname>
<foaf:family_name>Saito</foaf:family_name>
<doac:summary>Assistant Professor at University of Tokyo</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<foaf:homepage rdf:resource="http://www.xerial.org/"/>
<foaf:homepage rdf:resource="http://leoclock.blogspost.com/"/>
<doac:experience>
<doac:Experience>
<doac:title>Assistant Professor</doac:title>
<doac:location>University of Tokyo</doac:location>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>The University of Tokyo</foaf:organization>
<doac:title>Ph.D</doac:title>
<doac:date-starts>1998-01-01</doac:date-starts>
<doac:date-ends>2007-12-31</doac:date-ends>
</doac:Education>
</doac:education>
<foaf:homepage rdf:resource="http://www.xerial.org/"/>
<foaf:homepage rdf:resource="http://leoclock.blogspost.com/"/>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=27869976">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=61680523">
<foaf:name>Venkata Satagopam</foaf:name>
<foaf:givenname>Venkata</foaf:givenname>
<foaf:family_name>Satagopam</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/1/000/041/19b/2de9d31.jpg">
<dc:title>Venkata Satagopam</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>Bioinformatician at EMBL</doac:summary>
<doac:experience>
<doac:Experience>
<doac:title>Bioinformatician</doac:title>
<doac:location>EMBL</doac:location>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Bioinformatics scientist (R&D)</doac:title>
<doac:location>LION bioscience AG</doac:location>
<doac:date-starts>2000</doac:date-starts>
<doac:date-ends>2003</doac:date-ends>
</doac:Experience>
</doac:experience>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=61680523">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>
<foaf:Person rdf:about="http://www.linkedin.com/ppl/webprofile?id=42025466">
<foaf:name>Yu Lin</foaf:name>
<foaf:givenname>Yu</foaf:givenname>
<foaf:family_name>Lin</foaf:family_name>
<foaf:depiction>
<foaf:Image rdf:about="http://media.linkedin.com/mpr/mpr/shrink_80_80/p/3/000/01e/317/09ddbcb.jpg">
<dc:title>Yu Lin</dc:title>
</foaf:Image>
</foaf:depiction>
<doac:summary>at CDB, RIKEN</doac:summary>
<foaf:based_near>
<geo:Point>
<dc:title>Japan, JP</dc:title>
<geo:long>139.753088951111</geo:long>
<geo:lat>35.6853569043379</geo:lat>
</geo:Point>
</foaf:based_near>
<doac:experience>
<doac:Experience>
<doac:title>Technician</doac:title>
<doac:location>RIKEN, CDB</doac:location>
<doac:date-starts>2009-05-01</doac:date-starts>
<doac:activity>Data analysis for transcriptome study using next generation sequencer, Roche 454, Other bioinformatics stuff and ontology...</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>website developer</doac:title>
<doac:location>MotorJapan.com</doac:location>
<doac:date-starts>2003-02-01</doac:date-starts>
<doac:activity>using PHP and MySQL built a Russian website for exporting used cars from Japan to Russia</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Ph.D. student</doac:title>
<doac:location>Kobe University Graduate School of Medicine</doac:location>
<doac:date-starts>2003-04-01</doac:date-starts>
<doac:date-ends>2009-03-01</doac:date-ends>
<doac:activity>working on ontologies of genetic susceptibility factors to Type 2 Diabetes, integrated MySQL database on genetics of Diabetes. Will finish on March, 2009</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Part-time contract researcher</doac:title>
<doac:location>Translational Research Informatics Center</doac:location>
<doac:date-starts>2002-11-01</doac:date-starts>
<doac:date-ends>2004-04-01</doac:date-ends>
<doac:activity>Working on the development of integrated databases for genetic and metabolic pathways of Diabetes.</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Content Manager & Project Manager</doac:title>
<doac:location>Shenzhen E-sun Internet Co.,Ltd.</doac:location>
<doac:date-starts>2000-07-01</doac:date-starts>
<doac:date-ends>2002-07-01</doac:date-ends>
<doac:activity>1.Responsible for content designing and maintaining of the biological knowledge and B2C website: www.bio-engine.com 2.Designed and directed the running of an online medicine bidding system cooperating with Hubei Province Government. 3.Designed an online Chinese national soccer lottery system Ver.1, which is still in use. (http://www.500wan.com)</doac:activity>
</doac:Experience>
</doac:experience>
<doac:experience>
<doac:Experience>
<doac:title>Pediatrician</doac:title>
<doac:location>Caomao Hospital</doac:location>
<doac:date-starts>1996-09-01</doac:date-starts>
<doac:date-ends>1997-08-01</doac:date-ends>
<doac:activity/>
</doac:Experience>
</doac:experience>
<doac:education>
<doac:Education>
<foaf:organization>Kobe University</foaf:organization>
<doac:title>Ph.D.</doac:title>
<doac:date-starts>2003-01-01</doac:date-starts>
<doac:date-ends>2009-12-31</doac:date-ends>
<doac:subject>Developed following ontologies:　Ontology of Genetic Susceptibility Factors(OGSF);Ontology of Geographic Region (OGR);Ontology of Glucose Metabolism Disorder (OGMD);Ontology for Genetic Interval (OGI) GeneticDiatebetes: an Integrated Relational Database on Genetics of Diabetes</doac:subject>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Tongji Medical College</foaf:organization>
<doac:title>M.Sc.</doac:title>
<doac:date-starts>1997-01-01</doac:date-starts>
<doac:date-ends>2000-12-31</doac:date-ends>
<doac:subject>Working on the construction of anti-TFR single chain Fv, completed the 3D molecular modelling through Internet.</doac:subject>
</doac:Education>
</doac:education>
<doac:education>
<doac:Education>
<foaf:organization>Tongji Medical College</foaf:organization>
<doac:title>M.D</doac:title>
<doac:date-starts>1991-01-01</doac:date-starts>
<doac:date-ends>1996-12-31</doac:date-ends>
<doac:subject/>
</doac:Education>
</doac:education>
<foaf:holdsAccount>
<foaf:OnlineAccount rdf:about="http://www.linkedin.com/ppl/webprofile?id=42025466">
<foaf:accountServiceHomepage rdf:resource="http://www.linkedin.com"/>
</foaf:OnlineAccount>
</foaf:holdsAccount>
</foaf:Person>


<foaf:Group rdf:about="http://hackathon3.dbcls.jp">
<foaf:name>BioHackathon 2010</foaf:name>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=11054862"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=3144981"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=34738971"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=18346806"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=17090435"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=65214809"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=14919228"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=10344427"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=27429075"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=61848948"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=103859"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=12968680"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=15498101"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=1510707"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=41305706"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=13686406"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=34770184"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=16314219"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=13051716"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=40227171"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=12409171"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=4889459"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=21783495"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=12738919"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=35979245"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=37942607"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=4631981"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=13946714"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=14071207"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=18946009"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=24539252"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=9705742"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=11849955"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=6070868"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=63377764"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=65153053"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=40273227"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=61573617"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=2302145"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=46763330"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=29841918"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=27869976"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=61680523"/>
<foaf:member rdf:resource="http://www.linkedin.com/ppl/webprofile?id=42025466"/>
</foaf:Group>
</rdf:RDF>

That's it
Pierre

Using a FASTA file as a source of RDF statements for SPARQL.

In this post, I'll show how a Fasta file can be used as a source of RDF statements for the Jena API.
The DNA sequences in the Fasta file will be used by Jena without any prior transformation: the file will be used as a Graph by Jena by implementing com.hp.hpl.jena.graph.Graph.

Here, my example uses a Fasta file but it could have been any kind of input: a SQL database, a XML file, a GFF file, etc...

How it works

com.hp.hpl.jena.graph.Graph is the interface to be satisfied by implementations maintaining collections of RDF triples. The core interface is small (add, delete, find, contains) and is augmented by additional classes to handle more complicated matters such as reification, query handling, bulk update, event management, and transaction handling. My implementation for this interface extends com.hp.hpl.jena.graph.impl.GraphBase, will read a Fasta file and create set of RDF triple for each sequence. All we need is (love and ) implementing the abstract function ExtendedIterator<Triple> graphBaseFind(TripleMatch matcher)

public class FastaModel
extends GraphBase
{
protected ExtendedIterator<Triple> graphBaseFind(TripleMatch matcher)
{
//the function to be implemented....
}
}

The FastaSequence

A simple container for a name and a sequence.

/** a simple fasta sequence */
private static class FastaSequence
{
StringBuilder name=new StringBuilder();
StringBuilder sequence=new StringBuilder();
}

Reading the next Fasta Sequence

... Not Rocket Science...

/** the file reader */
private PushbackReader reader;
(...)
reader=new PushbackReader(new FileReader(fastaFile));
(...)
private FastaSequence readNext() throws IOException
{
if(this.reader==null) return null;
int c;
FastaSequence seq=null;
while((c=this.reader.read())!=-1)
{
if(c=='>')
{
if(seq!=null)
{
this.reader.unread(c);
return seq;
}
seq=new FastaSequence();
while((c=this.reader.read())!=-1)
{
if(c=='\n') break;
seq.name.append((char)c);
}
}
else if(seq!=null && Character.isLetter(c))
{
seq.sequence.append((char)c);
}
}
this.close();//close the FileReader
return seq;
}

Implementing the Iterator of Triples

My FastaIterator extends jena.util.iterator.NiceIterator<Triple>, a class extening the ExtendedIterator returned by the Graph function ExtendedIterator<Triple> graphBaseFind(TripleMatch matcher). The class contains three fields:

• a FileReader
• com.hp.hpl.jena.graph.Triple that is used as a filter
• a stack/queue of RDF Triples

. The constructor for 'FastaIterator' opens the stream:

FastaIterator(TripleMatch matcher) throws IOException
{
this.filter=matcher.asTriple();
try
{
this.reader=new PushbackReader(new FileReader(FastaModel.this.fastaFile));
}
catch (IOException e)
{
throw new JenaException(e);
}
}

The method 'close' just close the input stream

@Override
public void close()
{
try
{
if(this.reader!=null) reader.close();
}
catch (IOException e)
{
throw new JenaException(e);
}
finally
{
this.reader=null;
super.close();
}

The method 'next()' check if there is something in the RDF queue, if true a RDF triple is removed and returned:

@Override
public Triple next()
{
if(this.triples_queue.isEmpty()) hasNext();
if(this.triples_queue.isEmpty()) throw new IllegalStateException();
return this.triples_queue.pop();
}

The method 'hasNext()' returns true if the queue of RDF triple is not empty. Otherwise, it gets the next Fasta Sequence
from the input stream and transforms it into a set of RDF triple that are added to the RDF queue if they match this.filter.That is to say, the following fasta sequence...:

>gi|227935373|gb|FJ425127.1| Rotavirus G8 isolate 6862/2000/ARN NSP3 gene, partial cds
GGCCACTTCAACATTAGAATTAATGGGTATTCAATATGATTACAATGAAGTATTTACCAGAGTTAAAAGT
AAATTTGATTATGTGATGGATGACTCTGGTGTTAAAAACAATCTTTTGGGTAAAGCTATAACTATTGATC
AGGCATTAAATGGAAAGTTTGGCTCAGCTATTAGAAATAGAAATTGGATGACTGATTCTAAAACGGTTGC
TAAATTAGATGAAGACGTGAATAAACTTAGAATGACATTATCTTCTAAAGGAATCGACCAAAAGATGAGA
GTACTTAATGCTTGTTTAGTGTA

... will generate those four RDF statements:

<http://www.ncbi.nlm.nih.gov/nuccore/227935373> <urn:lindenb:ontology:length> "303"^^<http://www.w3.org/2001/XMLSchema#int>
<http://www.ncbi.nlm.nih.gov/nuccore/227935373> <urn:lindenb:ontology:sequence> "GGCCACTTCAACATTAGAATTAATGGGTATTCAATATGATTACAATGAAGTATTTACCAGAGTTAAAAGTAAATTTGATTATGTGATGGATGACTCTGGTGTTAAAAACAATCTTTTGGGTAAAGCTATAACTATTGATCAGGCATTAAATGGAAAGTTTGGCTCAGCTATTAGAAATAGAAATTGGATGACTGATTCTAAAACGGTTGCTAAATTAGATGAAGACGTGAATAAACTTAGAATGACATTATCTTCTAAAGGAATCGACCAAAAGATGAGAGTACTTAATGCTTGTTTAGTGTA"
<http://www.ncbi.nlm.nih.gov/nuccore/227935373> <http://purl.org/dc/elements/1.1/title> "gi|227935373|gb|FJ425127.1| Rotavirus G8 isolate 6862/2000/ARN NSP3 gene, partial cds"
<http://www.ncbi.nlm.nih.gov/nuccore/227935373> <http://www.w3.org/1999/02/22-rdf-syntax-ns#type> <urn:lindenb:ontology:Sequence>

Here is the code for the 'hasNext' function:

@Override
public boolean hasNext()
{
if(!triples_queue.isEmpty()) return true;
if(this.reader==null) return false;
try
{
/* loop until the queue is not empty or the stream is closed */
while(this.triples_queue.isEmpty())
{
//try to get a new fasta sequence
FastaSequence seq=readNext();
if(seq==null) return false;

String name=seq.name.toString();
//check it is a genbank file with a gi
if(!name.startsWith("gi|"))
{
continue;
}
int i=name.indexOf('|',3);
if(i==-1) continue;
//create the subject
Node subject =Node.createURI("http://www.ncbi.nlm.nih.gov/nuccore/"+name.substring(3,i));

//make a triple for the rdf:type
Triple triple=new Triple(
subject,
RDF.type.asNode(),
Node.createURI("urn:lindenb:ontology:Sequence")
);
//append this triple to the queue if it is accepted by this.filter
if(this.filter.asTriple().matches(triple))
{
this.triples_queue.add(triple);
}

//make a triple for the dc:title
triple=new Triple(
subject,
DC.title.asNode(),
Node.createLiteral(name)
);

//append this triple to the queue if it is accepted by this.filter
if(this.filter.asTriple().matches(triple))
{
this.triples_queue.add(triple);
}

//make a triple for the DNA sequence
triple=new Triple(
subject,
Node.createURI("urn:lindenb:ontology:sequence"),
Node.createLiteral(seq.sequence.toString())
);

//append this triple to the queue if it is accepted by this.filter
if(this.filter.asTriple().matches(triple))
{
this.triples_queue.add(triple);
}

//make a triple for the size of this sequence
triple=new Triple(
subject,
Node.createURI("urn:lindenb:ontology:length"),
Node.createLiteral(String.valueOf(seq.sequence.length()),null,XSDDatatype.XSDint)
);

//append this triple to the queue if it is accepted by this.filter
if(this.filter.asTriple().matches(triple))
{
this.triples_queue.add(triple);
}

}
}
catch (IOException e)
{
close();
throw new JenaException(e);
}
return !triples_queue.isEmpty();
}

Using the graph

.

Creating a new Jena RDF Model

Model m=ModelFactory.createModelForGraph(
new FastaModel(
new File("rotavirus.fa")
));

Looping over the RDF statements

After creating this new Model, it can be used as a regular Jena RDF Model. e.g:

StmtIterator i=m.listStatements();
while(i.hasNext())
{
System.err.println(i.next());
}

Result

[http://www.ncbi.nlm.nih.gov/nuccore/227935373, urn:lindenb:ontology:length, "303"^^http://www.w3.org/2001/XMLSchema#int]
[http://www.ncbi.nlm.nih.gov/nuccore/227935373, urn:lindenb:ontology:sequence, "GGCCACTTCAACATTAGAATTAATGGGTATTCAATATGATTACAATGAAGTATTTACCAGAGTTAAAAGTAAATTTGATTATGTGATGGATGACTCTGGTGTTAAAAACAATCTTTTGGGTAAAGCTATAACTATTGATCAGGCATTAAATGGAAAGTTTGGCTCAGCTATTAGAAATAGAAATTGGATGACTGATTCTAAAACGGTTGCTAAATTAGATGAAGACGTGAATAAACTTAGAATGACATTATCTTCTAAAGGAATCGACCAAAAGATGAGAGTACTTAATGCTTGTTTAGTGTA"]
[http://www.ncbi.nlm.nih.gov/nuccore/227935373, http://purl.org/dc/elements/1.1/title, "gi|227935373|gb|FJ425127.1| Rotavirus G8 isolate 6862/2000/ARN NSP3 gene, partial cds"]
[http://www.ncbi.nlm.nih.gov/nuccore/227935373, http://www.w3.org/1999/02/22-rdf-syntax-ns#type, urn:lindenb:ontology:Sequence]
[http://www.ncbi.nlm.nih.gov/nuccore/227935371, urn:lindenb:ontology:length, "303"^^http://www.w3.org/2001/XMLSchema#int]
[http://www.ncbi.nlm.nih.gov/nuccore/227935371, urn:lindenb:ontology:sequence, "GGCCACTTCAACATTAGAATTAATGGGTATTCAATATGATTACAATGAAGTATTTACCAGAGTTAAAAGTAAATTTGATTATGTGATGGATGACTCTGGTGTTAAAAACAATCTTTTGGGTAAAGCTATAACTATTGATCAGGCATTAAATGGAAAGTTTGGCTCAGCTATTAGAAATAGAAATTGGATGACTGATTCTAAAACGGTTGCTAAATTAGATGAAGACGTGAATAAACTTAGAATGACATTATCTTCTAAAGGAATCGACCAAAAGATGAGAGTACTTAATGCTTGTTTAGTGTA"]
[http://www.ncbi.nlm.nih.gov/nuccore/227935371, http://purl.org/dc/elements/1.1/title, "gi|227935371|gb|FJ425126.1| Rotavirus G8 isolate 6854/2002/ARN NSP3 gene, partial cds"]
[http://www.ncbi.nlm.nih.gov/nuccore/227935371, http://www.w3.org/1999/02/22-rdf-syntax-ns#type, urn:lindenb:ontology:Sequence]
[http://www.ncbi.nlm.nih.gov/nuccore/227935369, urn:lindenb:ontology:length, "303"^^http://www.w3.org/2001/XMLSchema#int]
[http://www.ncbi.nlm.nih.gov/nuccore/227935369, urn:lindenb:ontology:sequence, "GGCCACTTCAACATTAGAATTAATGGGTATTCAATATGATTACAATGAAGTATTTACCAGAGTTAAAAGTAAATTTGATTATGTGATGGATGACTCTGGTGTTAAAAACAATCTTCTGGGTAAAGCTATAACTATTGATCAGGCATTAAATGGAAAGTTTGGCTCAGCTATTAGAAATAGAAATTGGATGACTGATTCTAAAACGGTTGCTAAATTAGATGAAGACGTGAATAAACTTAGAATGACATTATCTTCTAAAGGAATCGACCAAAAGATGAGAGTACTTAATGCTTGTTTAGTGTA"]
[http://www.ncbi.nlm.nih.gov/nuccore/227935369, http://purl.org/dc/elements/1.1/title, "gi|227935369|gb|FJ425125.1| Rotavirus G8 isolate 6810/2004/ARN NSP3 gene, partial cds"]
(...)

This model can also be used as a source of RDF by ARQ , the SPARQL engine for Jena (!). Here we create a new SPARQL engine and list the sequences having a length lower than the others

Query query=QueryFactory.create(
"SELECT ?Seq1 ?Len1 ?Seq2 ?Len2" +
"{" +
"?Seq1 a <urn:lindenb:ontology:Sequence> . " +
"?Seq1 <urn:lindenb:ontology:length> ?Len1 . " +
"?Seq2 a <urn:lindenb:ontology:Sequence> . " +
"?Seq2 <urn:lindenb:ontology:length> ?Len2 . " +
"FILTER (?Seq1!=?Seq2 && ?Len1 < ?Len2) "+
"}"
);
QueryExecution execution = QueryExecutionFactory.create(query, m);
ResultSet row=execution.execSelect();
while(row.hasNext())
{
QuerySolution solution=row.next();

for(Iterator<String> si=solution.varNames();si.hasNext();)
{
String name=si.next();
System.out.println(name+" : "+solution.get(name));
}
System.out.println();
}

Result:

Seq1 : http://www.ncbi.nlm.nih.gov/nuccore/227935373
Len1 : 303^^http://www.w3.org/2001/XMLSchema#int
Seq2 : http://www.ncbi.nlm.nih.gov/nuccore/227935361
Len2 : 304^^http://www.w3.org/2001/XMLSchema#int

Seq1 : http://www.ncbi.nlm.nih.gov/nuccore/227935373
Len1 : 303^^http://www.w3.org/2001/XMLSchema#int
Seq2 : http://www.ncbi.nlm.nih.gov/nuccore/227935359
Len2 : 304^^http://www.w3.org/2001/XMLSchema#int

Seq1 : http://www.ncbi.nlm.nih.gov/nuccore/227935373
Len1 : 303^^http://www.w3.org/2001/XMLSchema#int
Seq2 : http://www.ncbi.nlm.nih.gov/nuccore/215489730
Len2 : 305^^http://www.w3.org/2001/XMLSchema#int

Seq1 : http://www.ncbi.nlm.nih.gov/nuccore/227935371
Len1 : 303^^http://www.w3.org/2001/XMLSchema#int
Seq2 : http://www.ncbi.nlm.nih.gov/nuccore/227935361
Len2 : 304^^http://www.w3.org/2001/XMLSchema#int

Seq1 : http://www.ncbi.nlm.nih.gov/nuccore/227935371
Len1 : 303^^http://www.w3.org/2001/XMLSchema#int
Seq2 : http://www.ncbi.nlm.nih.gov/nuccore/227935359
Len2 : 304^^http://www.w3.org/2001/XMLSchema#int

Seq1 : http://www.ncbi.nlm.nih.gov/nuccore/227935371
Len1 : 303^^http://www.w3.org/2001/XMLSchema#int
Seq2 : http://www.ncbi.nlm.nih.gov/nuccore/215489730
Len2 : 305^^http://www.w3.org/2001/XMLSchema#int

Seq1 : http://www.ncbi.nlm.nih.gov/nuccore/227935369
Len1 : 303^^http://www.w3.org/2001/XMLSchema#int
Seq2 : http://www.ncbi.nlm.nih.gov/nuccore/227935361
Len2 : 304^^http://www.w3.org/2001/XMLSchema#int
(...)

Hey, I thinks it's coool ! :-)
BTW I wonder how, knowing the FILTER of the SPARQL query, searching the Graph can be optimized, for example if we know that the sequences have been sorted in the fasta file according to their lengths.... Any idea ?

Compiling

export JENAPATH=${JENALIB}/icu4j-3.4.4.jar:${JENALIB}/iri-0.7.jar:${JENALIB}/jena-2.6.2.jar:${JENALIB}/jena-2.6.2-tests.jar:${JENALIB}/junit-4.5.jar:${JENALIB}/log4j-1.2.13.jar:${JENALIB}/lucene-core-2.3.1.jar:${JENALIB}/slf4j-api-1.5.6.jar:${JENALIB}/slf4j-log4j12-1.5.6.jar:${JENALIB}/stax-api-1.0.1.jar:${JENALIB}/wstx-asl-3.2.9.jar:${JENALIB}/xercesImpl-2.7.1.jar:${JENALIB}/icu4j-3.4.4.jar:${JENALIB}/iri-0.7.jar:${JENALIB}/jena-2.6.2.jar:${JENALIB}/jena-2.6.2-tests.jar:${JENALIB}/junit-4.5.jar:${JENALIB}/log4j-1.2.13.jar:${JENALIB}/lucene-core-2.3.1.jar:${JENALIB}/slf4j-api-1.5.6.jar:${JENALIB}/slf4j-log4j12-1.5.6.jar:${JENALIB}/stax-api-1.0.1.jar:${JENALIB}/wstx-asl-3.2.9.jar:${JENALIB}/xercesImpl-2.7.1.jar:${JENALIB}/arq-2.8.1.jar
javac -cp ${JENAPATH}:. -d bin -sourcepath src src/test/FastaModel.java

Running

java -cp ${JENAPATH}:bin test.FastaModel

All, in one, here is the code

That's it !
Pierre

Searching for Genotypes with SPARQL.

This week-end, I've noticed that the NCBI has an interface called Genotype Query Form used to query some genotypes the generating the following kind of XML output:

<GenoExchange xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns="http://www.ncbi.nlm
.nih.gov/SNP/geno" xsi:schemaLocation="http://www.ncbi.nlm.nih.gov/SNP/geno ftp://ftp.ncbi.nlm.nih.gov/snp/specs/genoex_1_4.xsd" dbSNPBuildNo="129">
<Population popId="1409" handle="CSHL-HAPMAP" locPopId="HapMap-CEU">
<popClass self="NOT SPECIFIED" />
</Population>
<Individual indId="170" taxId="9606" sex="F" indGroup="European">
<SourceInfo source="Coriell" sourceType="repository" ncbiPedId="80" pedId="1340" indId="NA07000" maId="0" paId="0" srcIndGroup="Western and Nothern European" />
<SubmitInfo popId="1409" submittedIndId="NA07000" subIndGroup="Western and Northern European" />
</Individual>
<Individual indId="621" taxId="9606" sex="F" indGroup="European">

(...)
<SnpLoc genomicAssembly="36:reference" chrom="1" start="1286927" locType="2" rsOrientToCh
rom="rev" contigAllele="C" />
<SsInfo ssId="3906671" locSnpId="AL139287.6_22772" ssOrientToRs="fwd">
<ByPop popId="1409" sampleSize="120">
<AlleleFreq allele="A" freq="0.117" />
<AlleleFreq allele="G" freq="0.883" />
<GTypeFreq gtype="A/G" freq="0.233" />
<GTypeFreq gtype="G/G" freq="0.767" />
(...)
<GTypeByInd indId="636" gtype="G/G" />
<GTypeByInd indId="456" gtype="G/G" />
<GTypeByInd indId="536" gtype="G/G" />
</ByPop>
</SsInfo>
<GTypeFreq gtype="A/A" freq="0.380952380952381" />
<GTypeFreq gtype="A/G" freq="0.352380952380952" />
<GTypeFreq gtype="G/G" freq="0.266666666666667" />
</SnpInfo>
<SnpInfo rsId="2765021" observed="A/G">
(...)

I wanted to see how one could query this kind of data with SPARQL... well, I'm sure that RDF is one of the most inefficient way to store this kind of data but I wanted to see what could be extracted from such RDFStore from a semantic query. First, I wrote a XSLT stylesheet transforming <GenoExchange/> to <rdf:RDF/>. The stylsheet is available at http://code.google.com/p/lindenb/source/browse/trunk/src/xsl/genoexch2rdf.xsl.
.

Transform the data

About 639 HAPMAP snps on the chromosome 1 were extracted using the HTML form and saved as XML to the file 'SNPgenotype-100201-1244-3905.xml'(size 4Mo). The xml was converted to RDF with the xsltproc engine:

xsltproc --stringparam "with-sequence" yes --novalid genoexch2rdf.xsl SNPgenotype-100201-1244-3905.xml > input.rdf

The size of 'input.rdf' (including the flanking sequences of the SNPs) was 20Mo.

Result

<?xml version="1.0"?>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:g="http://www.ncbi.nlm.nih.gov/SNP/geno" xmlns:snp="http://www.ncbi.nlm.nih.gov/SNP/docsum" xmlns="http://ontology.lindenb.org/genotypes/">
<Population rdf:about="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&amp;pop_id=1409">
<handle>CSHL-HAPMAP</handle>
<locPopId>HapMap-CEU</locPopId>
</Population>
<Individual rdf:about="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=170">
<hasPop rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&amp;pop_id=1409"/>
<sex>F</sex>
<name>NA07000</name>
</Individual>
<Individual rdf:about="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=621">
<hasPop rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&amp;pop_id=1409"/>
<sex>F</sex>
<name>NA12875</name>
</Individual>
<Individual rdf:about="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=538">
<hasPop rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&amp;pop_id=1409"/>
<sex>F</sex>
<name>NA12753</name>
(...)
<SNP rdf:about="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=307347">
<het rdf:datatype="http://www.w3.org/2001/XMLSchema#float">0.1</het>
<name>rs307347</name>
<seq5>GGGGATGGCTGCTCCTGGGCCTCAGAAAGATGCAGTCCCATAGACTTCCAGCACGCCCCTCCCCTCCTCGGGCCTTAATTTTGTCCACTGAGAAGATGGTCTCTGAGGCTCTGGGGTTTCCTTCTTGGTCACCAGATATTCTGCGGGCCTTGCCTTCCTGCCCAGATTCGAGCCAGTGGCAAACAGAAGCTGCCAGGAGC</seq5>
<observed>C/T</observed>
<seq3>TCTCAGAGCTGTGGCTGGTGGCTCGGTAACAACAGGAAGGGCAGTGGCTGTGCAGGAGGCAGGCAGCTTGCCAGCCCAGGAAGGTGACCCAGGACACCTCCAGGCCTTTCCCAGGGCAGCCCAACGGCCCAAGGTCAGGGCCGGGCGCGAGGGCGGCCTGAGCACAGAGCACGGGGGCTGACAGCAGGCTGGGGGGCCAG</seq3>
</SNP>
<MapLoc>
<hasSNP rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=307347"/>
<strand>+</strand>
<chrom>1</chrom>
<start rdf:datatype="http://www.w3.org/2001/XMLSchema#integer">1320381</start>
<assembly rdf:resource="urn:assembly:Celera:36_3"/>
<type>exact</type>
</MapLoc>
(...)
<Genotype>
<hasIndi rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=465"/>
<hasSNP rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=940550"/>
<allele1>T</allele1>
<allele2>T</allele2>
</Genotype>
<Genotype>
<hasIndi rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=253"/>
<hasSNP rdf:resource="http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=940550"/>
<allele1>T</allele1>
<allele2>T</allele2>
</Genotype>
</rdf:RDF>

Invoking ARQ

export ARQROOT=ARQ-2.5.0
ARQ-2.5.0/bin/arq --data ~/input.rdf --query ~/query01.rq

Dump All

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
SELECT ?s ?p ?o {?s ?p ?o.}

Result

| _:b0 | g:allele2 | "C" |
| _:b0 | g:allele1 | "C" |
| _:b0 | g:hasSNP | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17160669> |
| _:b0 | g:hasIndi | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=636> |
| _:b0 | rdf:type | g:Genotype |
| _:b1 | g:allele2 | "T" |
| _:b1 | g:allele1 | "C" |
| _:b1 | g:hasSNP | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17160669> |
| _:b1 | g:hasIndi | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=361> |
| _:b1 | rdf:type | g:Genotype |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=174> | g:name | "NA07048" |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=174> | g:sex | "M" |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=174> | g:hasPop | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&pop_id=1409> |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=174> | rdf:type | g:Individual |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=566> | g:name | "NA12802" |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=566> | g:sex | "F" |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=566> | g:hasPop | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_viewTable.cgi?type=pop&pop_id=1409> |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=566> | rdf:type | g:Individual |
| _:b2 | g:allele2 | "A" |
| _:b2 | g:allele1 | "A" |
| _:b2 | g:hasSNP | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=2765021> |
| _:b2 | g:hasIndi | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=429> |
| _:b2 | rdf:type | g:Genotype |
| _:b3 | g:allele2 | "C" |
| _:b3 | g:allele1 | "C" |
| _:b3 | g:hasSNP | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17160669> |
| _:b3 | g:hasIndi | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=546> |
| _:b3 | rdf:type | g:Genotype |
| _:b4 | g:allele2 | "T" |
| _:b4 | g:allele1 | "C" |
| _:b4 | g:hasSNP | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=17160669> |
| _:b4 | g:hasIndi | <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=159> |
| _:b4 | rdf:type | g:Genotype |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=621> | g:name | "NA12875" |
| <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ind.cgi?ind_id=621> | g:sex | "F" |
(...)

Select the populations

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
SELECT ?pop
{
?s a g:Population .
?s g:handle ?pop .
}

Result

-----------------
| pop |
=================
| "CSHL-HAPMAP" |
-----------------

List six individuals for each population

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
SELECT ?pop ?indi_name ?good
{
?s a g:Population .
?s g:handle ?pop .
?s2 a g:Individual .
?s2 g:hasPop ?s .
?s2 g:sex ?good .
?s2 g:name ?indi_name
}
limit 6

Result

------------------------------------
| pop | indi_name | good |
====================================
| "CSHL-HAPMAP" | "NA10854" | "F" |
| "CSHL-HAPMAP" | "NA12264" | "M" |
| "CSHL-HAPMAP" | "NA11993" | "F" |
| "CSHL-HAPMAP" | "NA10830" | "M" |
| "CSHL-HAPMAP" | "NA12762" | "M" |
| "CSHL-HAPMAP" | "NA12155" | "M" |
------------------------------------

List the SNPs having a flanking sequence containing 'CACACA'

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
PREFIX fn: <http://www.w3.org/2005/xpath-functions#>

SELECT ?name ?seq5 ?observed ?seq3
WHERE
{
?s a g:SNP .
?s g:name ?name .
?s g:seq5 ?seq5 .
?s g:seq3 ?seq3 .
?s g:observed ?observed .

FILTER (
fn:contains(fn:upper-case(?seq5), "CACACA") ||
fn:contains(fn:upper-case(?seq3), "CACACA")
)
}

Result

-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
| name | seq5 | observed | seq3 |
=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
| "rs17160669" | "GCCACCGCGCCTGGCCCACAAGCATAACTTTTATAAAAATAATTTACTTTTACAATTAAGCTTAGGAATCACACAGACTCAGGGCTGGCTCATGGCTTCC" | "C/T" | "GGCAAGTTAAACTCTGTACTTAGGCTCGGCGCGTATGAAATGGCTAATTCTAATCAGTGGTGCAATGAAGTAACTCCTCTAAAGAACTTATCGGGCCGGG" |
| "rs2765023" | "ACTTGTAAATTTAGTCAGCATACATAACTAACCAAAACTTCAATATATCTTGAGACCCCCTTGGGGGGCTGTCTCCATAAAAGTGACTTTCCCAGGAGAGTGACTGGATGTGATTGGCCAACACCGTCTTAGCCCGCAGGGGTTCCTGGCGCGGAAGCCTCACGTCCCTCCCCACAGCGAGTTTTCAGAATCCAAAGGCCGTAGGAGAAAGAAGGCTGGCGGTGTTTCCTCTTAGAGGGGAGAAACTCAGCCTGGGTAGGAGACCCAGCCCCACGCAGGGAAAACTGTGCTAACGCTTCC" | "A/G" | "ATGTGCGTGGCAGGTGCGGCGGCGGCGAATACGGTTTGTCCTCGAGCCTAACCCTGTCTGTGTTGGTGTCAGCAGTGGCCCCCCTACCACACACACAGGGTCCCTGGCGTCCCAAGACCACTCCTGGCAGCCCCGCCACTGGCTGCGCCTGGAAGCCGCGTCCTCAGGCCTCGCCTGGCATTTGCTGTCACAGAGGTTGCTTCCTTGGGTCCGTCCGTCCTCGCCCCTCCAGCCTGGGCGCCCCCCCACCCCTGTCTCATTCCCTCCACCACATGCAGCACAGTCCAGGAGGCTGGGGTC" |
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Get 12 Heterozygous Genotypes

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
PREFIX fn: <http://www.w3.org/2005/xpath-functions#>

SELECT ?indi ?snp ?a1 ?a2
WHERE
{
?s a g:Genotype .
?s g:allele1 ?a1 .
?s g:allele2 ?a2 .
?s g:hasIndi ?s2 .
?s2 g:name ?indi .
?s g:hasSNP ?s3 .
?s3 g:name ?snp .
FILTER ( ?a1 != ?a2 )
}
LIMIT 10

Result

----------------------------------------
| indi | snp | a1 | a2 |
========================================
| "NA12056" | "rs17160669" | "C" | "T" |
| "NA12716" | "rs17160669" | "C" | "T" |
| "NA12761" | "rs17160669" | "C" | "T" |
| "NA10839" | "rs2765023" | "A" | "G" |
| "NA12813" | "rs2765023" | "A" | "G" |
| "NA12760" | "rs2765023" | "A" | "G" |
| "NA12865" | "rs17160669" | "C" | "T" |
| "NA07056" | "rs17160669" | "C" | "T" |
| "NA12146" | "rs2765023" | "A" | "G" |
| "NA10860" | "rs2765023" | "A" | "G" |
| "NA10839" | "rs17160669" | "C" | "T" |
| "NA12812" | "rs17160669" | "C" | "T" |
----------------------------------------

List 12 SNPs on chr1 between 100000 and 500000 on the reference assembly, order by chrom/position

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
PREFIX fn: <http://www.w3.org/2005/xpath-functions#>

SELECT ?snp ?chrom ?orient ?start
WHERE
{
?s a g:SNP .
?s g:name ?snp .
?s2 a g:MapLoc .
?s2 g:hasSNP ?s .
?s2 g:chrom ?chrom .
?s2 g:chrom "1" .
?s2 g:strand ?orient .
?s2 g:start ?start .
?s2 g:assembly <urn:assembly:reference:36_3> .
FILTER ( ?start > 100000 && ?start< 500000)
}
ORDER BY ?chrom ?start
LIMIT 12

Result

------------------------------------------
| snp | chrom | orient | start |
==========================================
| "rs17009015" | "1" | "-" | 121810 |
| "rs11490937" | "1" | "+" | 222076 |
| "rs12041624" | "1" | "+" | 232164 |
| "rs11514575" | "1" | "-" | 235726 |
| "rs4731490" | "1" | "+" | 311783 |
| "rs4006867" | "1" | "+" | 325493 |
| "rs7462951" | "1" | "-" | 360984 |
| "rs4030300" | "1" | "+" | 392471 |
| "rs4030303" | "1" | "+" | 392552 |
| "rs9661032" | "1" | "-" | 396549 |
| "rs3872250" | "1" | "-" | 400742 |
| "rs3907361" | "1" | "-" | 412985 |
------------------------------------------

List the positions of 10 SNPs on the reference assembly and chr1, print the heterozygosity if it exists and is greater than 0.1

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>

SELECT ?snp ?chrom ?orient ?start ?het
WHERE
{
?s a g:SNP .
?s g:name ?snp .
?s2 a g:MapLoc .
?s2 g:hasSNP ?s .
?s2 g:chrom ?chrom .
?s2 g:chrom "1" .
?s2 g:strand ?orient .
?s2 g:start ?start .
?s2 g:assembly <urn:assembly:reference:36_3> .
OPTIONAL { ?s g:het ?het . FILTER ( ?het > 0.1 ) }
}
LIMIT 10

Result

------------------------------------------------------------------------------------------------
| snp | chrom | orient | start | het |
================================================================================================
| "rs7417504" | "1" | "+" | 555799 | |
| "rs10018120" | "1" | "-" | 241387750 | "0.48"^^<http://www.w3.org/2001/XMLSchema#float> |
| "rs12043546" | "1" | "+" | 224043895 | |
| "rs4023296" | "1" | "-" | 141776514 | |
| "rs1320571" | "1" | "+" | 1110293 | "0.31"^^<http://www.w3.org/2001/XMLSchema#float> |
| "rs1359759" | "1" | "+" | 115826181 | "0.49"^^<http://www.w3.org/2001/XMLSchema#float> |
| "rs7553429" | "1" | "+" | 1080419 | "0.19"^^<http://www.w3.org/2001/XMLSchema#float> |
| "rs4245756" | "1" | "+" | 789325 | |
| "rs3766177" | "1" | "-" | 1471210 | "0.5"^^<http://www.w3.org/2001/XMLSchema#float> |
| "rs9442372" | "1" | "+" | 1008566 | "0.46"^^<http://www.w3.org/2001/XMLSchema#float> |
------------------------------------------------------------------------------------------------

Print 10 differences between the Reference Assembly and the Celera Assembly

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>

SELECT ?snp ?chrom1 ?orient1 ?start1 ?chrom2 ?orient2 ?start2
WHERE
{
?s a g:SNP .
?s g:name ?snp .

?s2 a g:MapLoc .
?s2 g:hasSNP ?s .
?s2 g:chrom ?chrom1 .
?s2 g:strand ?orient1 .
?s2 g:start ?start1 .
?s2 g:assembly <urn:assembly:Celera:36_3> .

?s3 a g:MapLoc .
?s3 g:hasSNP ?s .
?s3 g:chrom ?chrom2 .
?s3 g:strand ?orient2 .
?s3 g:start ?start2 .
?s3 g:assembly <urn:assembly:reference:36_3> . .

}
LIMIT 10

Result

-----------------------------------------------------------------------------
| snp | chrom1 | orient1 | start1 | chrom2 | orient2 | start2 |
=============================================================================
| "rs7553640" | "1" | "-" | 833104 | "1" | "+" | 1751873 |
| "rs3951936" | "9" | "-" | 41330304 | "4" | "+" | 49186295 |
| "rs3951936" | "9" | "-" | 41330304 | "1" | "-" | 142233119 |
| "rs3951936" | "9" | "-" | 41330304 | "1" | "+" | 142038296 |
| "rs3951936" | "9" | "-" | 41330304 | "1" | "-" | 141781399 |
| "rs3951936" | "9" | "-" | 41330304 | "1" | "+" | 141641811 |
| "rs41319344" | "Y" | "+" | 10690990 | "Y" | "-" | 25853159 |
| "rs41319344" | "Y" | "+" | 10690990 | "Y" | "+" | 24928047 |
| "rs41319344" | "Y" | "+" | 10690990 | "1" | "-" | 241194834 |
| "rs10907183" | "1" | "-" | 1511375 | "1" | "+" | 1060980 |
-----------------------------------------------------------------------------

Create a new RDF graph of 10 SNPs having a neighbour at a distance less than 500pb

Query

PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX g: <http://ontology.lindenb.org/genotypes/>
PREFIX fn: <http://www.w3.org/2005/xpath-functions#>

CONSTRUCT { ?snp1 g:hasNeighbour ?snp2 . }
WHERE
{
?snp1 a g:SNP .
?snp2 a g:SNP .

?s1 a g:MapLoc .
?s1 g:hasSNP ?snp1 .
?s1 g:chrom ?chrom1 .
?s1 g:strand ?orient1 .
?s1 g:start ?start1 .
?s1 g:assembly <urn:assembly:reference:36_3> .

?s2 a g:MapLoc .
?s2 g:hasSNP ?snp2 .
?s2 g:chrom ?chrom2 .
?s2 g:strand ?orient2 .
?s2 g:start ?start2 .
?s2 g:assembly <urn:assembly:reference:36_3> .

FILTER( (fn:abs(?start1 - ?start2) < 500) && ?chrom1=?chrom2 && ?snp1!=?snp2)

}
LIMIT 10

Result

@prefix : <http://ontology.lindenb.org/genotypes/> .
@prefix g: <http://ontology.lindenb.org/genotypes/> .
@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
@prefix fn: <http://www.w3.org/2005/xpath-functions#> .

<http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=7545812>
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=9970455> .

<http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=1043506>
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=12126411> .

<http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=6603793>
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=7548693> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=7553066> .

<http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=10907178>
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=10907177> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=11260588> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=11260587> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=6701114> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=3737728> ;
:hasNeighbour <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=9442398> .

That's it !
Pierre