An interactive 'dialog' generating a SAM Flag

The following shell script uses the dialog utility to generate a numeric Sam flag.

$ sh selectsam.sh 
      ┌───────────────────────SAM FLAGS──────────────────────────┐
      │ SELECT FLAGS                                             │  
      │ ┌──────────────────────────────────────────────────────┐ │  
      │ │ [X] 1     Read Paired                                │ │  
      │ │ [ ] 2     Read mapped in proper pair                 │ │  
      │ │ [X] 4     Read unmapped                              │ │  
      │ │ [ ] 8     Mate unmapped                              │ │  
      │ │ [ ] 16    Read reverse strand                        │ │  
      │ │ [X] 32    Mate reverse strand                        │ │  
      │ │ [ ] 64    First in pair                              │ │  
      │ │ [X] 128   Second in pair                             │ │  
      │ │ [ ] 256   Not primary alignment                      │ │  
      │ │ [ ] 512   Read fails platform/vendor quality checks  │ │  
      │ │ [ ] 1024  Read is PCR or optical duplicate           │ │  
      │ └─────↓(+)─────────────────────────────────────────────┘ │  
      │                                                          │  
      │                                                          │  
      ├──────────────────────────────────────────────────────────┤  
      │                         <  OK  >                         │  
      └──────────────────────────────────────────────────────────┘  
        
$ 165

Source available at: https://github.com/lindenb/samtools-utilities/blob/master/script/selectflag.sh

That's it,

Pierre

I can't save you, but I can help you: reverse-complementing a DNA in OpenOffice

People in my lab are using "Microsoft Word" to edit and annotate their sequences. Just like Neil, I can't save them but I can help them: here is an OpenOffice / LibreOffice macro reverse-complementing the current selected text.

• open libreoffice/openoffice
• Open menu "Tools / Macros / Organize macros / Basic...
• Select "My Macros/Standard" and click on "New"
• Copy+paste my macro here
• Click on the top button "compile"
• Close the dialog
• Menu "Tools/Customize" , "Keyboard" tab, "Toolbar content" . Button "Add... " / Category "Libre Office Macros" . Select "My Macro/Standard/Modulexxx"/ReverseComplementSelection". Click on "Modify" to assign an icon to this new button
• There is now a new button in the toolbar. Clicking on that button reverse-complements the selected text.

That's it,

Pierre

PS: Hum ? what did you say, they use Microsoft Word ? Not OpenOffice ? pfff....

A text alignment viewer using the samtools API

I wrote a modified version of samtools tview. The original code uses the curses API to display an interactive sequence viewer.

I wanted to generate this kind of screen for a large number of positions and I wanted to be able to redirect the output to a unix pipeline so I changed the original code in order to only handle an extensible 2-dimensional array of characters. The code I wrote is available on github at:

https://github.com/lindenb/samtools-utilities/blob/master/src/ttview.c

.

Compilation

cd samtools/
make #compile samtools
gcc -o bamttview -g -Wall -O2 -DSTANDALONE_VERSION  -I. -Lbcftools  bam_ttview.c  bam2bcf.o   errmod.o  bam_color.o libbam.a -lbcf  -lm -lz

Example

print a position

$ ./bamttview  -g "ref:5" examples/toy.bam examples/toy.fa |\
cat -n
     1       11              21        31         41        51        61          
     2 TGTTAGATAA****GATA**GCTGTGCTAGTAGGCAG*TCAGCGCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     3   ........    ....  ......K.K......K. ..........                                
     4   ........AGAG....***...      ,,,,,    ,,,,,,,,,                                
     5     ......GG**....AA                                                            
     6     ..C...**** ...**...>>>>>>>>>>>>>>T.....                                     

print a list of positions:

$ cat positions.txt 
ref2:10-100
ref:10-15
ref2:11

$ ./bamttview  -f positions.txt examples/toy.bam examples/toy.fa |\
cat -n | head -n 25
     1 
     2 
     3 > ref2:10-100
     4 
     5  11            21        31        41        51        61        71             
     6 aaaac****aattaagtctacagagcaactaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     7 ....Y    ..W...................                                                 
     8 .....****..A...                                                                 
     9 .....****..A...T.                                                               
    10 .....AAAT.............                                                          
    11 C...T****....................                                                   
    12   ..T****.....................                                                  
    13     T****......................                                                 
    14 
    15 
    16 
    17 > ref:10-15
    18 
    19  11              21        31         41        51        61        71          
    20 GATAA****GATA**GCTGTGCTAGTAGGCAG*TCAGCGCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    21 .....    ....  ......K.K......K. ..........                                     
    22 .....AGAG....***...      ,,,,,    ,,,,,,,,,                                     
    23 .....GG**....AA                                                                 
    24 .C...**** ...**...>>>>>>>>>>>>>>T.....                                          
    25 

./bamttview  -f positions.txt -d examples/toy.bam examples/toy.fa |\
cat -n | head -n 25
     1 
     2 
     3 > ref2:10-100
     4 
     5  11            21        31        41        51        61        71             
     6 aaaac****aattaagtctacagagcaactaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     7 ....Y    ..W...................                                                 
     8 AAAAC****AAATAA                                                                 
     9 AAAAC****AAATAATT                                                               
    10 AAAACAAATAATTAAGTCTACA                                                          
    11 CAAAT****AATTAAGTCTACAGAGCAAC                                                   
    12   AAT****AATTAAGTCTACAGAGCAACT                                                  
    13     T****AATTAAGTCTACAGAGCAACTA                                                 
    14 
    15 
    16 
    17 > ref:10-15
    18 
    19  11              21        31         41        51        61        71          
    20 GATAA****GATA**GCTGTGCTAGTAGGCAG*TCAGCGCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    21 .....    ....  ......K.K......K. ..........                                     
    22 GATAAAGAGGATA***CTG      taggc    cagcgccat                                     
    23 GATAAGG**GATAAA                                                                 
    24 GCTAA**** ATA**GCT>>>>>>>>>>>>>>TTCAGC                                          
    25 

That's it,

Pierre

Storing SNPs in a HDF5 file: my notebook

I discovered the benefits of using twitter in 2008, the day Deepak Singh replied to one of my tweets related to the storage of a large number of genotypes.

Since that day, I've tried to use the HDF5 library, without any success (there's a large disheartening documentation/API on the HDF5 site and the API seems to be only used by a small number of geeks). Furthermore, HDF5 is a technology used by the IGV genome browser.

In that post, I'll describe a C program loading a set of SNPs defined by the following C structure:

typedef struct structSnp
 {
 char rsId[RS_LENGTH];//rs##
 char chrom[CHROM_LENGTH];//chromosome name
 int chromStart;//genomic start index
 int chromEnd;//genomic end index
 }Snp;

The SNPs will be read from stdin. Four columns are expected: rs-id, chrom, chromStart and chromEnd. Here is the command line I used to get a small input file:

curl -s "http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/snp132.txt.gz" |\
 gunzip -c |\
 cut -d ' ' -f 2-5 |\
 head -n 10000 > sample.tsv

Source code

The C program is described below. I hope my comments will make the code readable.

The Makefile

Compile and run

gcc -Wall -o a.out -I  /path/to/hdf5/include -L /path/to/hdf5/lib dbsnp2hdf5.c  -lhdf5
./a.out < sample.tsv

Dump the data

At the en, the program creates a structured binary file containing our SNPs. The HDF5 utility h5dump can be used to display the data as text:

$ h5dump storage.h5

HDF5 "storage.h5" {
GROUP "/" {
   GROUP "variations" {
      DATASET "dbSNP" {
         DATATYPE  H5T_COMPOUND {
            H5T_STRING {
               STRSIZE 13;
               STRPAD H5T_STR_NULLTERM;
               CSET H5T_CSET_ASCII;
               CTYPE H5T_C_S1;
            } "rs";
            H5T_STRING {
               STRSIZE 7;
               STRPAD H5T_STR_NULLTERM;
               CSET H5T_CSET_ASCII;
               CTYPE H5T_C_S1;
            } "chrom";
            H5T_STD_I32LE "chromStart";
            H5T_STD_I32LE "chromEnd";
         }
         DATASPACE  SIMPLE { ( 10000 ) / ( H5S_UNLIMITED ) }
         DATA {
         (0): {
               "rs112750067",
               "chr1",
               10326,
               10327
            },
         (1): {
               "rs56289060",
               "chr1",
               10433,
               10433
            },
         (2): {
               "rs112155239",
               "chr1",
               10439,
               10440
            },
         (3): {
               "rs112766696",
               "chr1",
               10439,
               10440
            },
          (...)
               450425,
               450426
            }
         }
         ATTRIBUTE "rdfs:comment" {
            DATATYPE  H5T_STRING {
                  STRSIZE 15;
                  STRPAD H5T_STR_NULLTERM;
                  CSET H5T_CSET_ASCII;
                  CTYPE H5T_C_S1;
               }
            DATASPACE  SCALAR
            DATA {
            (0): "My list of SNPs"
            }
         }
      }
   }
}
}

That's it !
Pierre

The Neo4j REST API. My notebook

Neo4j is a open-source graph engine implemented in Java. This post is my notebook for the Neo4J-server, a server combining a REST API and a webadmin application into a single stand-alone server.

Download & extract Neo4J

Download Neo4J from here

$ tar xfz neo4j-community-1.4.M04-unix.tar.gz
$ rm neo4j-community-1.4.M04-unix.tar.gz
$ cd neo4j-community-1.4.M04/

Start the Neo4J Server

#edit the config file if needed
$ nano conf/neo4j-server.properties
#start the server
$ ./bin/neo4j start
Starting Neo4j Server...
Waiting for Neo4j Server.....
7/4/11 7:07:13 PM org.neo4j.server.database.Database INFO: Using database at NEO4J/neo4j-community-1.4.M04/data/graph.db
7/4/11 7:07:13 PM org.neo4j.server.modules.DiscoveryModule INFO: Mounted discovery module at [/]
Adding JAXRS packages [org.neo4j.server.rest.discovery] at [/]
Adding JAXRS packages [org.neo4j.server.rest.web] at [/db/data]
Adding JAXRS packages [org.neo4j.server.webadmin.rest] at [/db/manage]
7/4/11 7:07:13 PM org.neo4j.server.modules.RESTApiModule INFO: Mounted REST API at [/db/data/]
7/4/11 7:07:13 PM org.neo4j.server.modules.ManagementApiModule INFO: Mounted management API at [/db/manage/]
7/4/11 7:07:13 PM org.neo4j.server.modules.WebAdminModule INFO: Mounted webadmin at [/webadmin]
7/4/11 7:07:13 PM org.neo4j.server.NeoServerWithEmbeddedWebServer INFO: Starting Neo Server on port [7474]
7/4/11 7:07:13 PM org.neo4j.server.web.Jetty6WebServer INFO: Mounting static content at [/webadmin] from [webadmin-html]
7/4/11 7:07:15 PM org.neo4j.server.NeoServerWithEmbeddedWebServer INFO: Server started on [http://okazaki:7474/]
running: PID:2816

Get the server root

$ curl -D - -H Accept:application/json "http://localhost:7474/db/data/"
HTTP/1.1 200 OK
Content-Length: 410
Content-Encoding: UTF-8
Content-Type: application/json
Access-Control-Allow-Origin: *
Server: Jetty(6.1.25)

{
  "relationship_index" : "http://localhost:7474/db/data/index/relationship",
  "node" : "http://localhost:7474/db/data/node",
  "relationship_types" : "http://localhost:7474/db/data/relationship/types",
  "extensions_info" : "http://localhost:7474/db/data/ext",
  "node_index" : "http://localhost:7474/db/data/index/node",
  "reference_node" : "http://localhost:7474/db/data/node/0",
  "extensions" : {
  }

Create an empty node

$ curl -D - -H Accept:application/json -X POST http://localhost:7474/db/data/node
HTTP/1.1 201 Created
Content-Length: 968
Location: http://localhost:7474/db/data/node/2
Content-Encoding: UTF-8
Content-Type: application/json
Access-Control-Allow-Origin: *
Server: Jetty(6.1.25)

{
  "outgoing_relationships" : "http://localhost:7474/db/data/node/2/relationships/out",
(...)

Set properties for this node

$ curl -D - -H Content-Type:application/json -X PUT \
   -d '{"name":"Charles Darwin","birthDate":"1809-02-12","deathDate":"1882-04-19","knownFor":["Voyage of the Beagle","On the Origin of Species evolution by natural selection"]}' \
   http://localhost:7474/db/data/node/2/properties
HTTP/1.1 204 No Content
Access-Control-Allow-Origin: *
Server: Jetty(6.1.25)

View this node

$ curl -D - -H Accept:application/json  http://localhost:7474/db/data/node/2HTTP/1.1 200 OK
Content-Length: 1166
Content-Encoding: UTF-8
Content-Type: application/json
Access-Control-Allow-Origin: *
Server: Jetty(6.1.25)

{
  "outgoing_relationships" : "http://localhost:7474/db/data/node/2/relationships/out",
  "data" : {
    "knownFor" : [ "Voyage of the Beagle", "On the Origin of Species evolution by natural selection" ],
    "name" : "Charles Darwin",
    "birthDate" : "1809-02-12",
    "deathDate" : "1882-04-19"
  },
  "traverse" : "http://localhost:7474/db/data/node/2/traverse/{returnType}",
  "all_typed_relationships" : "http://localhost:7474/db/data/node/2/relationships/all/{-list|&|types}",
  "property" : "http://localhost:7474/db/data/node/2/properties/{key}",
  "self" : "http://localhost:7474/db/data/node/2",
  "properties" : "http://localhost:7474/db/data/node/2/properties",
  "outgoing_typed_relationships" : "http://localhost:7474/db/data/node/2/relationships/out/{-list|&|types}",
  "incoming_relationships" : "http://localhost:7474/db/data/node/2/relationships/in",
  "extensions" : {
  },
  "create_relationship" : "http://localhost:7474/db/data/node/2/relationships",
  "all_relationships" : "http://localhost:7474/db/data/node/2/relationships/all",
  "incoming_typed_relationships" : "http://localhost:7474/db/data/node/2/relationships/in/{-list|&|types}"
}

Only show the properties for that node:

$ curl -H Accept:application/json  http://localhost:7474/db/data/node/2/properties
{
  "knownFor" : [ "Voyage of the Beagle", "On the Origin of Species evolution by natural selection" ],
  "name" : "Charles Darwin",
  "birthDate" : "1809-02-12",
  "deathDate" : "1882-04-19"
}

Create a new node with some properties

$ curl -D - -H Accept:application/json -H Content-Type:application/json -X POST -d '{"name":"Alfred Russel Wallace","birthDate":"1823-01-08","deathDate":"1913-11-07","knownFor":["natural selection","biogeography"]}' "http://localhost:7474/db/data/node"
HTTP/1.1 201 Created
Content-Length: 1127
Location: http://localhost:7474/db/data/node/3
Content-Encoding: UTF-8
Content-Type: application/json
Access-Control-Allow-Origin: *
Server: Jetty(6.1.25)

{
  "outgoing_relationships" : "http://localhost:7474/db/data/node/3/relationships/out",
  "data" : {
    "knownFor" : [ "natural selection", "biogeography" ],
    "name" : "Alfred Russel Wallace",
    "birthDate" : "1823-01-08",
    "deathDate" : "1913-11-07"
  },
  "traverse" : "http://localhost:7474/db/data/node/3/traverse/{returnType}",
  (...)
}

Set one property

$ curl D - -H Accept:application/json -H Content-Type:application/json -X PUT \
     -d '"United Kingdom"' \
     "http://localhost:7474/db/data/node/3/properties/citizenship"
HTTP/1.1 204 No Content
Access-Control-Allow-Origin: *
Server: Jetty(6.1.25)

$ curl -H Accept:application/json  http://localhost:7474/db/data/node/3/properties{
  "knownFor" : [ "natural selection", "biogeography" ],
  "name" : "Alfred Russel Wallace",
  "citizenship" : "United Kingdom",
  "birthDate" : "1823-01-08",
  "deathDate" : "1913-11-07"
}

Remove a node

$ curl -D - -H Accept:application/json -X POST http://localhost:7474/db/data/node
HTTP/1.1 201 Created
Content-Length: 968
Location: http://localhost:7474/db/data/node/4
Content-Encoding: UTF-8
Content-Type: application/json
Access-Control-Allow-Origin: *
Server: Jetty(6.1.25)

$ curl -D - -X DELETE http://localhost:7474/db/data/node/4
HTTP/1.1 204 No Content
Access-Control-Allow-Origin: *
Server: Jetty(6.1.25)

Create a relationship from Darwin to Wallace

$ curl -D - -H Accept:application/json -H Content-Type:application/json -X POST -d '{"type":"KNOWS","to":"http://localhost:7474/db/data/node/3","data":{"ref":"http://en.wikipedia.org/wiki/Charles_Darwin"}}' "http://localhost:7474/db/data/node/2/relationships"
HTTP/1.1 201 Created
Content-Length: 439
Location: http://localhost:7474/db/data/relationship/0
Content-Encoding: UTF-8
Content-Type: application/json
Access-Control-Allow-Origin: *
Server: Jetty(6.1.25)

{
  "start" : "http://localhost:7474/db/data/node/2",
  "data" : {
    "ref" : "http://en.wikipedia.org/wiki/Charles_Darwin"
  },
  "self" : "http://localhost:7474/db/data/relationship/0",
  "property" : "http://localhost:7474/db/data/relationship/0/properties/{key}",
  "properties" : "http://localhost:7474/db/data/relationship/0/properties",
  "type" : "KNOWS",
  "extensions" : {
  },
  "end" : "http://localhost:7474/db/data/node/3"
}

#view properties for this relationship
$ curl -H Content-Type:application/json "http://localhost:7474/db/data/relationship/0/properties" 
{
  "ref" : "http://en.wikipedia.org/wiki/Charles_Darwin"
}

Add another property to the relationship

$ curl -D - -H Content-Type:application/json  -X PUT -d '"Darwin received a letter from Wallace asking if the book would examine human origins"' "http://localhost:7474/db/data/relationship/0/properties/comment"
HTTP/1.1 204 No Content
Access-Control-Allow-Origin: *
Server: Jetty(6.1.25)

$ curl -H Content-Type:application/json "http://localhost:7474/db/data/relationship/0/properties"
{
  "ref" : "http://en.wikipedia.org/wiki/Charles_Darwin",
  "comment" : "Darwin received a letter from Wallace asking if the book would examine human origins"
}

List Types of Relationship

$ curl -H Content-Type:application/json "http://localhost:7474/db/data/relationship/types"
["KNOWS"]

List Relationships

#from Darwin
$ curl -H Content-Type:application/json "http://localhost:7474/db/data/node/2/relationships/out/KNOWS"
[ {
  "start" : "http://localhost:7474/db/data/node/2",
  "data" : {
    "ref" : "http://en.wikipedia.org/wiki/Charles_Darwin",
    "comment" : "Darwin received a letter from Wallace asking if the book would examine human origins"
  },
  "self" : "http://localhost:7474/db/data/relationship/0",
  "property" : "http://localhost:7474/db/data/relationship/0/properties/{key}",
  "properties" : "http://localhost:7474/db/data/relationship/0/properties",
  "type" : "KNOWS",
  "extensions" : {
  },
  "end" : "http://localhost:7474/db/data/node/3"
} ]
#in to Darwin
$ curl -H Content-Type:application/json "http://localhost:7474/db/data/node/2/relationships/in/KNOWS"
[ ]
#out from wallace
$ curl -H Content-Type:application/json "http://localhost:7474/db/data/node/3/relationships/out/KNOWS"
[ ]
#all from/to wallace
$ curl -H Content-Type:application/json "http://localhost:7474/db/data/node/3/relationships/all/KNOWS"
[ {
  "start" : "http://localhost:7474/db/data/node/2",
  "data" : {
    "ref" : "http://en.wikipedia.org/wiki/Charles_Darwin",
    "comment" : "Darwin received a letter from Wallace asking if the book would examine human origins"
  },
  "self" : "http://localhost:7474/db/data/relationship/0",
  "property" : "http://localhost:7474/db/data/relationship/0/properties/{key}",
  "properties" : "http://localhost:7474/db/data/relationship/0/properties",
  "type" : "KNOWS",
  "extensions" : {
  },
  "end" : "http://localhost:7474/db/data/node/3"
} ]

Stop the Neo4J Server

$ ./bin/neo4j stop
Stopping Neo4j Server...
7/4/11 7:09:30 PM org.neo4j.server.NeoServerBootstrapper INFO: Neo4j Server shutdown initiated by kill signal
7/4/11 7:09:30 PM org.neo4j.server.NeoServerWithEmbeddedWebServer INFO: Successfully shutdown Neo Server on port [7474]
Waiting for Neo4j Server to exit...
Stopped Neo4j Server.

That's all for today, next time I'll dive into the indexes.

See also

The path from EgonWillighagen to Jandot : Neo4j , a graph API for java: my notebook.

That's it,

Pierre

The java library for BigBed and BigWig: my notebook

Jim Robinson and his team, from the Broad Institute/IGV, have recently released a java library parsing the BigBed and the BigWig formats. Here is my notebook for this API.

Download and compile the library

The sources are hosted at: http://bigwig.googlecode.com/.

$ svn checkout http://bigwig.googlecode.com/svn/trunk/ bigwig-read-only
$ cd bigwig-read-only
$ ant

Buildfile: build.xml

compile:
    [mkdir] Created dir: /path/to/bigwig-read-only/build
    [javac] Compiling 38 source files to /path/to/bigwig-read-only/build
    [javac] Note: /path/to/bigwig-read-only/src/org/broad/igv/bbfile/BPTree.java uses unchecked or unsafe operations.
    [javac] Note: Recompile with -Xlint:unchecked for details.

dist:
    [mkdir] Created dir: /path/to/bigwig-read-only/dist
      [jar] Building jar: /path/to/bigwig-read-only/dist/BigWig.jar

BUILD SUCCESSFUL
Total time: 3 seconds

Code

The following java code prints all the Bed or the Wig data in a given genomics region.

Compile

$javac -cp /path/to/bigwig-read-only/dist/BigWig.jar:. BigCat.java

Test

List the data in a BigBed file:

java -cp /path/to/bigwig-read-only/dist/BigWig.jar:/path/to/bigwig-read-only/lib/log4j-1.2.15.jar:. BigCat /path/to/bigwig-read-only/test/data/chr21.bb  | head
chr21 9434178 9434609 
chr21 9434178 9434609 
chr21 9508110 9508214 
chr21 9516607 9516987 
chr21 9903013 9903230 
chr21 9903013 9903230 
chr21 9905661 9906613 
chr21 9907217 9907519 
chr21 9907241 9907415 
chr21 9907597 9908258

List the data in a BigBed file for the region: 'chr21:9906000-9908000', allow the overlaps.

$ java -cp /path/to/bigwig-read-only/dist/BigWig.jar:/path/to/bigwig-read-only/lib/log4j-1.2.15.jar:. BigCat -p chr21:9906000-9908000 /path/to/bigwig-read-only/test/data/chr21.bb  | head
chr21 9905661 9906613 
chr21 9907217 9907519 
chr21 9907241 9907415 
chr21 9907597 9908258

List the data in a BigBed file for the region: 'chr21:9906000-9908000', do not allow the overlaps.

$ java -cp /path/to/bigwig-read-only/dist/BigWig.jar:/path/to/bigwig-read-only/lib/log4j-1.2.15.jar:. BigCat -p chr21:9906000-9908000 -c /path/to/bigwig-read-only/test/data/chr21.bb  | head
chr21 9907217 9907519 
chr21 9907241 9907415

List the data in a BigWig file:

$ java -cp /path/to/bigwig-read-only/dist/BigWig.jar:/path/to/bigwig-read-only/lib/log4j-1.2.15.jar:. BigCat  /path/to/bigwig-read-only/test/data/wigVarStepExample.bw  | head
chr21 9411190 9411195 50.0
chr21 9411195 9411200 40.0
chr21 9411200 9411205 60.0
chr21 9411205 9411210 20.0
chr21 9411210 9411215 20.0
chr21 9411215 9411220 20.0
chr21 9411220 9411225 40.0
chr21 9411225 9411230 60.0
chr21 9411230 9411235 40.0
chr21 9411235 9411240 40.0

List the data in a BigWig file for the region: 'chr21:9906000-9908000'

$ java -cp /path/to/bigwig-read-only/dist/BigWig.jar:/path/to/bigwig-read-only/lib/log4j-1.2.15.jar:. BigCat -p chr21:9906000-9908000 /path/to/bigwig-read-only/test/data/wigVarStepExample.bw  | head
chr21 9906000 9906005 20.0
chr21 9906005 9906010 60.0
chr21 9906010 9906015 60.0
chr21 9906015 9906020 60.0
chr21 9906020 9906025 80.0
chr21 9906025 9906030 60.0
chr21 9906030 9906035 40.0
chr21 9906035 9906040 80.0
chr21 9906040 9906045 80.0
chr21 9906045 9906050 80.0

See also

• Biostar: Java parser for BigWig ?
• Handling a BigWig file from Java+JNI : my notebook

That's it,

Pierre