Here I show how a XSLT stylesheet can be used to transform a Blast into a XHTML+SVG page.
The stylesheet described here is available [here]
Here is how it works, at the beginning we've got a blast output in XML (here the query was a murine histone vs the human genome)
<?xml version="1.0"?>
<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "NCBI_BlastOutput.dtd">
<BlastOutput>
<BlastOutput_program>blastn</BlastOutput_program>
<BlastOutput_version>blastn 2.2.5 [Nov-16-2002]</BlastOutput_version>
<BlastOutput_reference>~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jin
ghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~"Gapped BLAST and PSI-BLAST: a new
generation of protein database search~programs", Nucleic Acids Res. 25:3389-3402.</BlastOutput_r
eference>
<BlastOutput_db>HumanGenome</BlastOutput_db>
<BlastOutput_query-ID>lcl|QUERY</BlastOutput_query-ID>
<BlastOutput_query-def>gi|34556456|gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complet
e cds</BlastOutput_query-def>
<BlastOutput_query-len>1680</BlastOutput_query-len>
<BlastOutput_param>
<Parameters>
<Parameters_expect>10</Parameters_expect>
<Parameters_sc-match>1</Parameters_sc-match>
<Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
<Parameters_gap-open>5</Parameters_gap-open>
<Parameters_gap-extend>2</Parameters_gap-extend>
<Parameters_filter>D</Parameters_filter>
</Parameters>
</BlastOutput_param>
<BlastOutput_iterations>
<Iteration>
<Iteration_iter-num>1</Iteration_iter-num>
<Iteration_hits>
<Hit>
<Hit_num>1</Hit_num>
<Hit_id>gnl|BL_ORD_ID|32</Hit_id>
<Hit_def>chr6</Hit_def>
<Hit_accession>32</Hit_accession>
<Hit_len>170975699</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>444.541</Hsp_bit-score>
<Hsp_score>224</Hsp_score>
<Hsp_evalue>7.76885e-122</Hsp_evalue>
<Hsp_query-from>209</Hsp_query-from>
<Hsp_query-to>580</Hsp_query-to>
<Hsp_hit-from>27883967</Hsp_hit-from>
<Hsp_hit-to>27884338</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>335</Hsp_identity>
<Hsp_positive>335</Hsp_positive>
<Hsp_align-len>372</Hsp_align-len>
<Hsp_qseq>ATGTCTGGCCGTGGCAAACAGGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGGTCTTCCCGGGCCGGGCTACAGTTCCC
GGTGGGGCGTGTGCACCGGCTGCTGCGCAAGGGCAACTACGCGGAGCGCGTGGGTGCCGGCGCGCCGGTATACATGGCGGCGGTGCTGGAGTACCTAACGGCCGAGATCC
TGGAGCTGGCGGGCAACGCGGCCCGCGACAACAAGAAGACGCGCATCATCCCGCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCAAA
GTGACGATCGCACAGGGCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAGACCGAGAGCCAC</Hsp_qseq>
<Hsp_hseq>ATGTCTGGGCGTGGCAAGCAGGGAGGCAAAGCTCGCGCCAAGGCCAAGACCCGCTCTTCTCGGGCCGGGCTTCAGTTTCC
CGTAGGCCGAGTGCATCGCCTGCTCCGCAAAGGCAACTATGCGGAGCGGGTCGGTGCTGGAGCGCCGGTGTACCTGGCGGCGGTGCTGGAGTACCTGACCGCCGAGATCC
TGGAGCTGGCTGGCAACGCGGCCCGCGACAACAAGAAGACTCGCATCATCCCGCGTCACCTCCAGCTGGCCATCCGCAACGATGAGGAGCTCAACAAGCTTCTGGGCAAA
GTCACCATCGCACAGGGTGGCGTCCTGCCCAACATCCAGGCCGTGCTACTGCCCAAGAAGACCGAGAGCCAC</Hsp_hseq>
<Hsp_midline>|||||||| |||||||| ||||||||||| || ||||||||||||||| | || ||||| ||||||||||| |||||
|| || || || ||||| || ||||| ||||| |||||||| |||||||| || ||||| || |||||||| ||| |||||||||||||||||||||| || |||||||
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| ||||||
||||| || ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>420.753</Hsp_bit-score>
<Hsp_score>212</Hsp_score>
<Hsp_evalue>1.1255e-114</Hsp_evalue>
<Hsp_query-from>580</Hsp_query-from>
<Hsp_query-to>209</Hsp_query-to>
<Hsp_hit-from>27890126</Hsp_hit-from>
<Hsp_hit-to>27890497</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>332</Hsp_identity>
<Hsp_positive>332</Hsp_positive>
<Hsp_align-len>372</Hsp_align-len>
<Hsp_qseq>GTGGCTCTCGGTCTTCTTGGGCAGCAGCACGGCCTGGATGTTGGGCAGGACGCCGCCCTGTGCGATCGTCACTTTGCCCA
GCAGCTTGTTGAGCTCCTCGTCGTTGCGGATGGCCAGCTGCAGGTGGCGCGGGATGATGCGCGTCTTCTTGTTGTCGCGGGCCGCGTTGCCCGCCAGCTCCAGGATCTCG
GCCGTTAGGTACTCCAGCACCGCCGCCATGTATACCGGCGCGCCGGCACCCACGCGCTCCGCGTAGTTGCCCTTGCGCAGCAGCCGGTGCACACGCCCCACCGGGAACTG
TAGCCCGGCCCGGGAAGACCGCGACTTGGCCTTGGCGCGGGCCTTGCCTCCCTGTTTGCCACGGCCAGACAT</Hsp_qseq>
<Hsp_hseq>GTGGCTCTCAGTTTTCTTTGGCAGCAGCACGGCCTGGATGTTGGGCAGGACGCCACCCTGTGCGATGGTGACTTTGCCCA
GAAGCTTGTTGAGCTCCTCATCGTTGCGGATGGCCAGCTGGAGGTGACGCGGGATGATGCGAGTCTTCTTGTTGTCGCGGGCCGCGTTGCCAGCCAGCTCCAGGATCTCG
GCGGTCAGGTACTCCAGCACCGCCGCCAGGTACACCGGCGCTCCAGCACCGACCCGCTCCGCATAGTTGCCTTTGCGGAGCAGGCGATGCACTCGGCCTACGGGAAACTG
AAGCCCGGCCCGAGAAGAGCGGGTCTTGGCCTTGGCGCGAGCTTTGCCTCCCTGCTTACCACGCCCAGACAT</Hsp_hseq>
<Hsp_midline>||||||||| || ||||| ||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||
|||| ||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
||||| || |||||||||||||||||||||| ||| |||||||| || ||||| || |||||||| |||||||| ||||| ||||| || ||||| || || || || ||
||| ||||||||||| ||||| || | ||||||||||||||| || ||||||||||| || ||||| ||||||||</Hsp_midline>
</Hsp>
(...)
</Hit_hsps>
</Hit>
</Iteration_hits>
<Iteration_stat>
<Statistics>
<Statistics_db-num>1</Statistics_db-num>
<Statistics_db-len>245522847</Statistics_db-len>
<Statistics_hsp-len>0</Statistics_hsp-len>
<Statistics_eff-space>5.13463e+12</Statistics_eff-space>
<Statistics_kappa>0.710605</Statistics_kappa>
<Statistics_lambda>1.37407</Statistics_lambda>
<Statistics_entropy>1.30725</Statistics_entropy>
</Statistics>
</Iteration_stat>
</Iteration>
</BlastOutput_iterations>
</BlastOutput>
<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "NCBI_BlastOutput.dtd">
<BlastOutput>
<BlastOutput_program>blastn</BlastOutput_program>
<BlastOutput_version>blastn 2.2.5 [Nov-16-2002]</BlastOutput_version>
<BlastOutput_reference>~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jin
ghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~"Gapped BLAST and PSI-BLAST: a new
generation of protein database search~programs", Nucleic Acids Res. 25:3389-3402.</BlastOutput_r
eference>
<BlastOutput_db>HumanGenome</BlastOutput_db>
<BlastOutput_query-ID>lcl|QUERY</BlastOutput_query-ID>
<BlastOutput_query-def>gi|34556456|gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complet
e cds</BlastOutput_query-def>
<BlastOutput_query-len>1680</BlastOutput_query-len>
<BlastOutput_param>
<Parameters>
<Parameters_expect>10</Parameters_expect>
<Parameters_sc-match>1</Parameters_sc-match>
<Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
<Parameters_gap-open>5</Parameters_gap-open>
<Parameters_gap-extend>2</Parameters_gap-extend>
<Parameters_filter>D</Parameters_filter>
</Parameters>
</BlastOutput_param>
<BlastOutput_iterations>
<Iteration>
<Iteration_iter-num>1</Iteration_iter-num>
<Iteration_hits>
<Hit>
<Hit_num>1</Hit_num>
<Hit_id>gnl|BL_ORD_ID|32</Hit_id>
<Hit_def>chr6</Hit_def>
<Hit_accession>32</Hit_accession>
<Hit_len>170975699</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>444.541</Hsp_bit-score>
<Hsp_score>224</Hsp_score>
<Hsp_evalue>7.76885e-122</Hsp_evalue>
<Hsp_query-from>209</Hsp_query-from>
<Hsp_query-to>580</Hsp_query-to>
<Hsp_hit-from>27883967</Hsp_hit-from>
<Hsp_hit-to>27884338</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>335</Hsp_identity>
<Hsp_positive>335</Hsp_positive>
<Hsp_align-len>372</Hsp_align-len>
<Hsp_qseq>ATGTCTGGCCGTGGCAAACAGGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGGTCTTCCCGGGCCGGGCTACAGTTCCC
GGTGGGGCGTGTGCACCGGCTGCTGCGCAAGGGCAACTACGCGGAGCGCGTGGGTGCCGGCGCGCCGGTATACATGGCGGCGGTGCTGGAGTACCTAACGGCCGAGATCC
TGGAGCTGGCGGGCAACGCGGCCCGCGACAACAAGAAGACGCGCATCATCCCGCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCAAA
GTGACGATCGCACAGGGCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAGACCGAGAGCCAC</Hsp_qseq>
<Hsp_hseq>ATGTCTGGGCGTGGCAAGCAGGGAGGCAAAGCTCGCGCCAAGGCCAAGACCCGCTCTTCTCGGGCCGGGCTTCAGTTTCC
CGTAGGCCGAGTGCATCGCCTGCTCCGCAAAGGCAACTATGCGGAGCGGGTCGGTGCTGGAGCGCCGGTGTACCTGGCGGCGGTGCTGGAGTACCTGACCGCCGAGATCC
TGGAGCTGGCTGGCAACGCGGCCCGCGACAACAAGAAGACTCGCATCATCCCGCGTCACCTCCAGCTGGCCATCCGCAACGATGAGGAGCTCAACAAGCTTCTGGGCAAA
GTCACCATCGCACAGGGTGGCGTCCTGCCCAACATCCAGGCCGTGCTACTGCCCAAGAAGACCGAGAGCCAC</Hsp_hseq>
<Hsp_midline>|||||||| |||||||| ||||||||||| || ||||||||||||||| | || ||||| ||||||||||| |||||
|| || || || ||||| || ||||| ||||| |||||||| |||||||| || ||||| || |||||||| ||| |||||||||||||||||||||| || |||||||
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| ||||||
||||| || ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>420.753</Hsp_bit-score>
<Hsp_score>212</Hsp_score>
<Hsp_evalue>1.1255e-114</Hsp_evalue>
<Hsp_query-from>580</Hsp_query-from>
<Hsp_query-to>209</Hsp_query-to>
<Hsp_hit-from>27890126</Hsp_hit-from>
<Hsp_hit-to>27890497</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>332</Hsp_identity>
<Hsp_positive>332</Hsp_positive>
<Hsp_align-len>372</Hsp_align-len>
<Hsp_qseq>GTGGCTCTCGGTCTTCTTGGGCAGCAGCACGGCCTGGATGTTGGGCAGGACGCCGCCCTGTGCGATCGTCACTTTGCCCA
GCAGCTTGTTGAGCTCCTCGTCGTTGCGGATGGCCAGCTGCAGGTGGCGCGGGATGATGCGCGTCTTCTTGTTGTCGCGGGCCGCGTTGCCCGCCAGCTCCAGGATCTCG
GCCGTTAGGTACTCCAGCACCGCCGCCATGTATACCGGCGCGCCGGCACCCACGCGCTCCGCGTAGTTGCCCTTGCGCAGCAGCCGGTGCACACGCCCCACCGGGAACTG
TAGCCCGGCCCGGGAAGACCGCGACTTGGCCTTGGCGCGGGCCTTGCCTCCCTGTTTGCCACGGCCAGACAT</Hsp_qseq>
<Hsp_hseq>GTGGCTCTCAGTTTTCTTTGGCAGCAGCACGGCCTGGATGTTGGGCAGGACGCCACCCTGTGCGATGGTGACTTTGCCCA
GAAGCTTGTTGAGCTCCTCATCGTTGCGGATGGCCAGCTGGAGGTGACGCGGGATGATGCGAGTCTTCTTGTTGTCGCGGGCCGCGTTGCCAGCCAGCTCCAGGATCTCG
GCGGTCAGGTACTCCAGCACCGCCGCCAGGTACACCGGCGCTCCAGCACCGACCCGCTCCGCATAGTTGCCTTTGCGGAGCAGGCGATGCACTCGGCCTACGGGAAACTG
AAGCCCGGCCCGAGAAGAGCGGGTCTTGGCCTTGGCGCGAGCTTTGCCTCCCTGCTTACCACGCCCAGACAT</Hsp_hseq>
<Hsp_midline>||||||||| || ||||| ||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||
|||| ||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
||||| || |||||||||||||||||||||| ||| |||||||| || ||||| || |||||||| |||||||| ||||| ||||| || ||||| || || || || ||
||| ||||||||||| ||||| || | ||||||||||||||| || ||||||||||| || ||||| ||||||||</Hsp_midline>
</Hsp>
(...)
</Hit_hsps>
</Hit>
</Iteration_hits>
<Iteration_stat>
<Statistics>
<Statistics_db-num>1</Statistics_db-num>
<Statistics_db-len>245522847</Statistics_db-len>
<Statistics_hsp-len>0</Statistics_hsp-len>
<Statistics_eff-space>5.13463e+12</Statistics_eff-space>
<Statistics_kappa>0.710605</Statistics_kappa>
<Statistics_lambda>1.37407</Statistics_lambda>
<Statistics_entropy>1.30725</Statistics_entropy>
</Statistics>
</Iteration_stat>
</Iteration>
</BlastOutput_iterations>
</BlastOutput>
And the XSLT stylesheet:
1 <?xml version="1.0" encoding="UTF-8"?>
2 <xsl:stylesheet
3 version="1.0"
4 xmlns:xsl="http://www.w3.org/1999/XSL/Transform"
5 xmlns:svg="http://www.w3.org/2000/svg"
6 xmlns:xlink="http://www.w3.org/1999/xlink"
7 xmlns:h="http://www.w3.org/1999/xhtml"
8 >
17 <!-- ========================================================================= -->
18 <xsl:output method='xml' indent='yes' omit-xml-declaration="no"/>
19 <!-- we preserve the spaces in that element -->
20 <xsl:preserve-space elements="svg:style h:style" />
21
22 <!-- ========================================================================= -->
23 <!-- the width of the SVG -->
24 <xsl:variable name="svg-width">800</xsl:variable>
25 <!-- height of a HSP -->
26 <xsl:variable name="hsp-height">10</xsl:variable>
27 <!-- total number of Hits in first blast iteration -->
28 <xsl:variable name="hit-count"><xsl:value-of select="count(BlastOutput/BlastOutput_iterations/Iteration[1]/Iteration_hits/Hit)"/></xsl:variable>
29 <!-- total number of HSP in first blast iteration -->
30 <xsl:variable name="hsp-count"><xsl:value-of select="count(BlastOutput/BlastOutput_iterations/Iteration[1]/Iteration_hits/Hit/Hit_hsps/Hsp)"/></xsl:variable>
31 <!-- query length (bases or amino acids ) -->
32 <xsl:variable name="query-length"><xsl:value-of select="BlastOutput/BlastOutput_query-len"/></xsl:variable>
33 <!-- margin between two hits -->
34 <xsl:variable name="space-between-hits"><xsl:value-of select="3* $hsp-height"/></xsl:variable>
35 <!-- height of all hits -->
36 <xsl:variable name="hits-height"><xsl:value-of select="$hsp-count * $hsp-height + ($hit-count + 1) * $space-between-hits"/></xsl:variable>
37 <!-- size of the top header -->
38 <xsl:variable name="header-height">50</xsl:variable>
39
40 <!-- ========================================================================= -->
41
42 <!-- matching the root node -->
43 <xsl:template match="/">
44 <!-- start XHTML -->
45 <h:html>
46 <h:head>
47 <h:style type="text/css">
48 body {
49 font-size:10px;
50 font-family:Helvetica;
51 background-color:rgb(150,150,150);
52 color:white;
53 }
54 </h:style>
55 <h:title><xsl:value-of select="BlastOutput/BlastOutput_query-def"/></h:title>
56 </h:head>
57 <h:body>
58 <h:h1>Blast Results</h:h1>
59 <h:div>
60 <h:h3>Parameters</h:h3>
61 <h:table>
62 <h:tr><h:th>Database</h:th><h:td><xsl:value-of select="BlastOutput/BlastOutput_db"/></h:td></h:tr>
63 <h:tr><h:th>Query ID</h:th><h:td><xsl:value-of select="BlastOutput/BlastOutput_query-ID"/></h:td></h:tr>
64 <h:tr><h:th>Query Def.</h:th><h:td><h:b><xsl:value-of select="BlastOutput/BlastOutput_query-def"/></h:b></h:td></h:tr>
65 <h:tr><h:th>Query Length</h:th><h:td><h:b><xsl:value-of select="BlastOutput/BlastOutput_query-len"/></h:b></h:td></h:tr>
66 <h:tr><h:th>Version</h:th><h:td><xsl:value-of select="BlastOutput/BlastOutput_version"/></h:td></h:tr>
67 <h:tr><h:th>Reference</h:th><h:td><h:a href="http://www.ncbi.nlm.nih.gov/pubmed/9254694"><xsl:value-of select="BlastOutput/BlastOutput_reference"/></h:a></h:td></h:tr>
68 </h:table>
69 </h:div>
70 <h:hr/>
71 <h:div style="text-align:center">
72
73 <!-- starts SVG figure -->
74 <xsl:element name="svg:svg">
75 <xsl:attribute name="version">1.0</xsl:attribute>
76 <xsl:attribute name="width"><xsl:value-of select="$svg-width"/></xsl:attribute>
77 <xsl:attribute name="height"><xsl:value-of select="$hits-height + $header-height "/></xsl:attribute>
78 <svg:title><xsl:value-of select="BlastOutput/BlastOutput_query-def"/></svg:title>
79 <svg:defs>
80 <svg:style type="text/css">
81 text.t1 {
82 fill:black;
83 font-size:<xsl:value-of select="$hsp-height - 2"/>px;
84 font-family:Helvetica;
85 }
86 text.t2 {
87 fill:blue;
88 font-size:<xsl:value-of select="$space-between-hits - 2"/>px;
89 font-family:Helvetica;
90 text-anchor:middle;
91 }
92 text.title {
93 fill:white;
94 stroke:black;
95 font-size:12px;
96 font-family:Helvetica;
97 text-anchor:middle;
98 alignment-baseline:middle;
99 }
100 line.grid {
101 stroke:lightgray;
102 stroke-width:1.5px;
103 }
104
105 rect.hit {
106 fill:none;
107 stroke:darkgray;
108 stroke-width:1px;
109 }
110 </svg:style>
111
112 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score1">
113 <svg:stop offset="5%" stop-color="red" />
114 <svg:stop offset="50%" stop-color="whitesmoke" />
115 <svg:stop offset="95%" stop-color="red" />
116 </svg:linearGradient>
117 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score2">
118 <svg:stop offset="5%" stop-color="orange" />
119 <svg:stop offset="50%" stop-color="whitesmoke" />
120 <svg:stop offset="95%" stop-color="orange" />
121 </svg:linearGradient>
122 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score3">
123 <svg:stop offset="5%" stop-color="green" />
124 <svg:stop offset="50%" stop-color="whitesmoke" />
125 <svg:stop offset="95%" stop-color="green" />
126 </svg:linearGradient>
127 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score4">
128 <svg:stop offset="5%" stop-color="blue" />
129 <svg:stop offset="50%" stop-color="whitesmoke" />
130 <svg:stop offset="95%" stop-color="blue" />
131 </svg:linearGradient>
132 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score5">
133 <svg:stop offset="5%" stop-color="black" />
134 <svg:stop offset="50%" stop-color="whitesmoke" />
135 <svg:stop offset="95%" stop-color="black" />
136 </svg:linearGradient>
137 </svg:defs>
138
139 <xsl:element name="svg:rect">
140 <xsl:attribute name="x">0</xsl:attribute>
141 <xsl:attribute name="y">0</xsl:attribute>
142 <xsl:attribute name="width"><xsl:value-of select="$svg-width - 1"/></xsl:attribute>
143 <xsl:attribute name="height"><xsl:value-of select="$hits-height + $header-height "/></xsl:attribute>
144 <xsl:attribute name="fill">whitesmoke</xsl:attribute>
145 <xsl:attribute name="stroke">blue</xsl:attribute>
146 </xsl:element>
147
148
149 <xsl:apply-templates select="BlastOutput"/>
150 </xsl:element>
151 <!-- end SVG figure -->
152
153 </h:div>
154 <h:hr/>
155 <xsl:apply-templates select="BlastOutput/BlastOutput_param/Parameters"/>
156 <h:hr/>
157 <h:p><h:b>SVG</h:b> figure generated with <h:a href="http://code.google.com/p/lindenb/source/browse/trunk/src/xsl/blast2svg.xsl">blast2svg</h:a>. <h:a href="http://plindenbaum.blogspot.com">Pierre Lindenbaum PhD</h:a> <h:i>( plindenbaum at yahoo dot fr )</h:i></h:p>
158
159 </h:body>
160 </h:html>
161 </xsl:template>
162 <!-- ========================================================================= -->
163 <!-- display parameters in a HTML table -->
164 <xsl:template match="Parameters">
165 <h:div>
166 <h:h3>Parameters</h:h3>
167 <h:table>
168 <h:tr><h:th>Expect</h:th><h:td><xsl:value-of select="Parameters_expect"/></h:td></h:tr>
169 <h:tr><h:th>Sc-match</h:th><h:td><xsl:value-of select="Parameters_sc-match"/></h:td></h:tr>
170 <h:tr><h:th>Sc-mismatch</h:th><h:td><xsl:value-of select="Parameters_sc-mismatch"/></h:td></h:tr>
171 <h:tr><h:th>Gap-open</h:th><h:td><xsl:value-of select="Parameters_gap-open"/></h:td></h:tr>
172 <h:tr><h:th>Gap-extend</h:th><h:td><xsl:value-of select="Parameters_gap-extend"/></h:td></h:tr>
173 <h:tr><h:th>Filter</h:th><h:td><xsl:value-of select="Parameters_filter"/></h:td></h:tr>
174 </h:table>
175 </h:div>
176 </xsl:template>
177
178
179 <!-- ========================================================================= -->
180 <xsl:template match="BlastOutput">
181 <!-- paint header -->
182 <svg:g>
183 <xsl:element name="svg:rect">
184 <xsl:attribute name="x">0</xsl:attribute>
185 <xsl:attribute name="y">0</xsl:attribute>
186 <xsl:attribute name="width"><xsl:value-of select="$svg-width - 1"/></xsl:attribute>
187 <xsl:attribute name="height"><xsl:value-of select="$header-height - 2"/></xsl:attribute>
188 <xsl:attribute name="fill">url(#score5)</xsl:attribute>
189 <xsl:attribute name="stroke">black</xsl:attribute>
190 </xsl:element>
191
192 <xsl:element name="svg:text">
193 <xsl:attribute name="x"><xsl:value-of select="$svg-width div 2"/></xsl:attribute>
194 <xsl:attribute name="y"><xsl:value-of select="$header-height div 2"/></xsl:attribute>
195 <xsl:attribute name="class">title</xsl:attribute>
196 <xsl:value-of select="BlastOutput_query-def"/> (len=<xsl:value-of select="BlastOutput_query-len"/> )
197 </xsl:element>
198 </svg:g>
199 <xsl:apply-templates select="BlastOutput_iterations/Iteration[1]/Iteration_hits"/>
200 </xsl:template>
201
202 <!-- ========================================================================= -->
203
204 <xsl:template match="Iteration_hits">
205 <xsl:apply-templates select="Hit"/>
206 </xsl:template>
207
208 <!-- ========================================================================= -->
209
210 <xsl:template match="Hit">
211 <!-- count number of preceding hits -->
212 <xsl:variable name="preceding-hits"><xsl:value-of select="count(preceding-sibling::Hit)"/></xsl:variable>
213 <!-- count number of preceding hsp -->
214 <xsl:variable name="preceding-hsp"><xsl:value-of select="count(preceding-sibling::Hit/Hit_hsps/Hsp)"/></xsl:variable>
215 <!-- calculate hieght of this part -->
216 <xsl:variable name="height"><xsl:value-of select="count(Hit_hsps/Hsp)*$hsp-height"/></xsl:variable>
217 <!-- translate this part verticaly -->
218 <xsl:element name="svg:g">
219 <xsl:attribute name="transform">translate(0,<xsl:value-of select="$header-height + $preceding-hsp * $hsp-height + ($preceding-hits + 1) * $space-between-hits "/>)</xsl:attribute>
220 <xsl:attribute name="id">hit-<xsl:value-of select="generate-id(.)"/></xsl:attribute>
221 <xsl:element name="svg:text">
222 <xsl:attribute name="x"><xsl:value-of select="$svg-width div 2"/></xsl:attribute>
223 <xsl:attribute name="y"><xsl:value-of select="-2"/></xsl:attribute>
224 <xsl:attribute name="class">t2</xsl:attribute>
225 <xsl:value-of select="Hit_def"/>
226 </xsl:element>
227 <xsl:element name="svg:rect">
228 <xsl:attribute name="x">0</xsl:attribute>
229 <xsl:attribute name="y">0</xsl:attribute>
230 <xsl:attribute name="width"><xsl:value-of select="$svg-width"/></xsl:attribute>
231 <xsl:attribute name="height"><xsl:value-of select="$height"/></xsl:attribute>
232 <xsl:attribute name="class">hit</xsl:attribute>
233 </xsl:element>
234
235 <xsl:call-template name="grid">
236 <xsl:with-param name="x" select="0"/>
237 <xsl:with-param name="d" select="20"/>
238 <xsl:with-param name="W" select="$svg-width"/>
239 <xsl:with-param name="H" select="$height"/>
240 </xsl:call-template>
241
242 <xsl:apply-templates select="Hit_hsps"/>
243
244
245
246 </xsl:element>
247 </xsl:template>
248
249 <!-- ========================================================================= -->
250 <!-- draw vertical lines , recursive template -->
251 <xsl:template name="grid">
252 <xsl:param name="x" select="0" />
253 <xsl:param name="d" select="20" />
254 <xsl:param name="W" select="0" />
255 <xsl:param name="H" select="0" />
256 <svg:line class="grid" x1="{$x}" x2="{$x}" y1="0" y2="{$H}"/>
257 <xsl:if test="$d + $x < $W">
258 <xsl:call-template name="grid">
259 <xsl:with-param name="x" select="$d + $x"/>
260 <xsl:with-param name="d" select="$d"/>
261 <xsl:with-param name="W" select="$W"/>
262 <xsl:with-param name="H" select="$H"/>
263 </xsl:call-template>
264 </xsl:if>
265 </xsl:template>
266
267 <!-- ========================================================================= -->
268
269 <xsl:template match="Hit_hsps">
270 <xsl:apply-templates select="Hsp"/>
271 </xsl:template>
272
273
274 <!-- ========================================================================= -->
275 <xsl:template match="Hsp">
276 <!-- number of previous hsp in the same Hit -->
277 <xsl:variable name="preceding-hsp"><xsl:value-of select="count(preceding-sibling::Hsp)"/></xsl:variable>
278 <!-- get the 5' position of the hsp in the query -->
279 <xsl:variable name="hsp-left"><xsl:choose>
280 <xsl:when test="Hsp_query-from < Hsp_query-to"><xsl:value-of select="Hsp_query-from"/></xsl:when>
281 <xsl:otherwise><xsl:value-of select="Hsp_query-to"/></xsl:otherwise>
282 </xsl:choose></xsl:variable>
283 <!-- get the 3' position of the hsp in the query -->
284 <xsl:variable name="hsp-right"><xsl:choose>
285 <xsl:when test="Hsp_query-from < Hsp_query-to"><xsl:value-of select="Hsp_query-to"/></xsl:when>
286 <xsl:otherwise><xsl:value-of select="Hsp_query-from"/></xsl:otherwise>
287 </xsl:choose></xsl:variable>
288 <!-- 5' position on screen -->
289 <xsl:variable name="x1"><xsl:value-of select="($hsp-left div $query-length ) * $svg-width"/></xsl:variable>
290 <!-- 3' position on screen -->
291 <xsl:variable name="x2"><xsl:value-of select="($hsp-right div $query-length ) * $svg-width"/></xsl:variable>
292 <!-- label -->
293 <xsl:variable name="label"><xsl:value-of select="Hsp_hit-from"/> - <xsl:value-of select="Hsp_hit-to"/> (<xsl:choose>
294 <xsl:when test="Hsp_query-from < Hsp_query-to">+</xsl:when>
295 <xsl:otherwise>-</xsl:otherwise></xsl:choose>) e=<xsl:value-of select="Hsp_evalue"/></xsl:variable>
296
297 <!-- translate this Hsp verticaly in its Hit -->
298 <xsl:element name="svg:g">
299 <xsl:attribute name="transform">translate(0,<xsl:value-of select="$preceding-hsp * $hsp-height"/>)</xsl:attribute>
300 <xsl:attribute name="id">hsp-<xsl:value-of select="generate-id(.)"/></xsl:attribute>
301 <xsl:attribute name="title"><xsl:value-of select="Hsp_evalue"/></xsl:attribute>
302
303 <!-- paint the Hsp Rectangle -->
304 <xsl:element name="svg:rect">
305 <xsl:attribute name="x"><xsl:value-of select="$x1"/></xsl:attribute>
306 <xsl:attribute name="y">2</xsl:attribute>
307 <xsl:attribute name="width"><xsl:value-of select="$x2 - $x1"/></xsl:attribute>
308 <xsl:attribute name="height"><xsl:value-of select="$hsp-height - 4"/></xsl:attribute>
309 <!-- choose a color according to the e-value -->
310 <xsl:attribute name="fill"><xsl:choose>
311 <xsl:when test="Hsp_evalue < 1E-100">url(#score1)</xsl:when>
312 <xsl:when test="Hsp_evalue < 1E-10">url(#score2)</xsl:when>
313 <xsl:when test="Hsp_evalue < 0.1">url(#score3)</xsl:when>
314 <xsl:when test="Hsp_evalue < 0">url(#score4)</xsl:when>
315 <xsl:otherwise>url(#score5)</xsl:otherwise>
316 </xsl:choose></xsl:attribute>
317 </xsl:element>
318
319 <!-- paint the label according to the position of the Hsp on screen -->
320 <xsl:choose>
321 <xsl:when test="$x2 < (0.75 * $svg-width)">
322 <xsl:element name="svg:text">
323 <xsl:attribute name="class">t1</xsl:attribute>
324 <xsl:attribute name="x"><xsl:value-of select="$x2 + 10 "/></xsl:attribute>
325 <xsl:attribute name="y"><xsl:value-of select="$hsp-height -1"/></xsl:attribute>
326 <xsl:attribute name="text-anchor">start</xsl:attribute>
327 <xsl:value-of select="$label"/>
328 </xsl:element>
329 </xsl:when>
330 <xsl:when test="$x1 > (0.25 * $svg-width)">
331 <xsl:element name="svg:text">
332 <xsl:attribute name="class">t1</xsl:attribute>
333 <xsl:attribute name="x"><xsl:value-of select="$x1 - 10 "/></xsl:attribute>
334 <xsl:attribute name="y"><xsl:value-of select="$hsp-height -1"/></xsl:attribute>
335 <xsl:attribute name="text-anchor">end</xsl:attribute>
336 <xsl:value-of select="$label"/>
337 </xsl:element>
338 </xsl:when>
339 <xsl:otherwise>
340 <xsl:element name="svg:text">
341 <xsl:attribute name="class">t1</xsl:attribute>
342 <xsl:attribute name="x"><xsl:value-of select="($x2 - $x1) div 2 "/></xsl:attribute>
343 <xsl:attribute name="y"><xsl:value-of select="$hsp-height -1"/></xsl:attribute>
344 <xsl:attribute name="text-anchor">middle</xsl:attribute>
345 <xsl:value-of select="$label"/>
346 </xsl:element>
347 </xsl:otherwise>
348 </xsl:choose>
349
350 </xsl:element>
351 </xsl:template>
352 <!-- ========================================================================= -->
353
354
355 </xsl:stylesheet>
2 <xsl:stylesheet
3 version="1.0"
4 xmlns:xsl="http://www.w3.org/1999/XSL/Transform"
5 xmlns:svg="http://www.w3.org/2000/svg"
6 xmlns:xlink="http://www.w3.org/1999/xlink"
7 xmlns:h="http://www.w3.org/1999/xhtml"
8 >
17 <!-- ========================================================================= -->
18 <xsl:output method='xml' indent='yes' omit-xml-declaration="no"/>
19 <!-- we preserve the spaces in that element -->
20 <xsl:preserve-space elements="svg:style h:style" />
21
22 <!-- ========================================================================= -->
23 <!-- the width of the SVG -->
24 <xsl:variable name="svg-width">800</xsl:variable>
25 <!-- height of a HSP -->
26 <xsl:variable name="hsp-height">10</xsl:variable>
27 <!-- total number of Hits in first blast iteration -->
28 <xsl:variable name="hit-count"><xsl:value-of select="count(BlastOutput/BlastOutput_iterations/Iteration[1]/Iteration_hits/Hit)"/></xsl:variable>
29 <!-- total number of HSP in first blast iteration -->
30 <xsl:variable name="hsp-count"><xsl:value-of select="count(BlastOutput/BlastOutput_iterations/Iteration[1]/Iteration_hits/Hit/Hit_hsps/Hsp)"/></xsl:variable>
31 <!-- query length (bases or amino acids ) -->
32 <xsl:variable name="query-length"><xsl:value-of select="BlastOutput/BlastOutput_query-len"/></xsl:variable>
33 <!-- margin between two hits -->
34 <xsl:variable name="space-between-hits"><xsl:value-of select="3* $hsp-height"/></xsl:variable>
35 <!-- height of all hits -->
36 <xsl:variable name="hits-height"><xsl:value-of select="$hsp-count * $hsp-height + ($hit-count + 1) * $space-between-hits"/></xsl:variable>
37 <!-- size of the top header -->
38 <xsl:variable name="header-height">50</xsl:variable>
39
40 <!-- ========================================================================= -->
41
42 <!-- matching the root node -->
43 <xsl:template match="/">
44 <!-- start XHTML -->
45 <h:html>
46 <h:head>
47 <h:style type="text/css">
48 body {
49 font-size:10px;
50 font-family:Helvetica;
51 background-color:rgb(150,150,150);
52 color:white;
53 }
54 </h:style>
55 <h:title><xsl:value-of select="BlastOutput/BlastOutput_query-def"/></h:title>
56 </h:head>
57 <h:body>
58 <h:h1>Blast Results</h:h1>
59 <h:div>
60 <h:h3>Parameters</h:h3>
61 <h:table>
62 <h:tr><h:th>Database</h:th><h:td><xsl:value-of select="BlastOutput/BlastOutput_db"/></h:td></h:tr>
63 <h:tr><h:th>Query ID</h:th><h:td><xsl:value-of select="BlastOutput/BlastOutput_query-ID"/></h:td></h:tr>
64 <h:tr><h:th>Query Def.</h:th><h:td><h:b><xsl:value-of select="BlastOutput/BlastOutput_query-def"/></h:b></h:td></h:tr>
65 <h:tr><h:th>Query Length</h:th><h:td><h:b><xsl:value-of select="BlastOutput/BlastOutput_query-len"/></h:b></h:td></h:tr>
66 <h:tr><h:th>Version</h:th><h:td><xsl:value-of select="BlastOutput/BlastOutput_version"/></h:td></h:tr>
67 <h:tr><h:th>Reference</h:th><h:td><h:a href="http://www.ncbi.nlm.nih.gov/pubmed/9254694"><xsl:value-of select="BlastOutput/BlastOutput_reference"/></h:a></h:td></h:tr>
68 </h:table>
69 </h:div>
70 <h:hr/>
71 <h:div style="text-align:center">
72
73 <!-- starts SVG figure -->
74 <xsl:element name="svg:svg">
75 <xsl:attribute name="version">1.0</xsl:attribute>
76 <xsl:attribute name="width"><xsl:value-of select="$svg-width"/></xsl:attribute>
77 <xsl:attribute name="height"><xsl:value-of select="$hits-height + $header-height "/></xsl:attribute>
78 <svg:title><xsl:value-of select="BlastOutput/BlastOutput_query-def"/></svg:title>
79 <svg:defs>
80 <svg:style type="text/css">
81 text.t1 {
82 fill:black;
83 font-size:<xsl:value-of select="$hsp-height - 2"/>px;
84 font-family:Helvetica;
85 }
86 text.t2 {
87 fill:blue;
88 font-size:<xsl:value-of select="$space-between-hits - 2"/>px;
89 font-family:Helvetica;
90 text-anchor:middle;
91 }
92 text.title {
93 fill:white;
94 stroke:black;
95 font-size:12px;
96 font-family:Helvetica;
97 text-anchor:middle;
98 alignment-baseline:middle;
99 }
100 line.grid {
101 stroke:lightgray;
102 stroke-width:1.5px;
103 }
104
105 rect.hit {
106 fill:none;
107 stroke:darkgray;
108 stroke-width:1px;
109 }
110 </svg:style>
111
112 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score1">
113 <svg:stop offset="5%" stop-color="red" />
114 <svg:stop offset="50%" stop-color="whitesmoke" />
115 <svg:stop offset="95%" stop-color="red" />
116 </svg:linearGradient>
117 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score2">
118 <svg:stop offset="5%" stop-color="orange" />
119 <svg:stop offset="50%" stop-color="whitesmoke" />
120 <svg:stop offset="95%" stop-color="orange" />
121 </svg:linearGradient>
122 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score3">
123 <svg:stop offset="5%" stop-color="green" />
124 <svg:stop offset="50%" stop-color="whitesmoke" />
125 <svg:stop offset="95%" stop-color="green" />
126 </svg:linearGradient>
127 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score4">
128 <svg:stop offset="5%" stop-color="blue" />
129 <svg:stop offset="50%" stop-color="whitesmoke" />
130 <svg:stop offset="95%" stop-color="blue" />
131 </svg:linearGradient>
132 <svg:linearGradient x1="0%" y1="0%" x2="0%" y2="100%" id="score5">
133 <svg:stop offset="5%" stop-color="black" />
134 <svg:stop offset="50%" stop-color="whitesmoke" />
135 <svg:stop offset="95%" stop-color="black" />
136 </svg:linearGradient>
137 </svg:defs>
138
139 <xsl:element name="svg:rect">
140 <xsl:attribute name="x">0</xsl:attribute>
141 <xsl:attribute name="y">0</xsl:attribute>
142 <xsl:attribute name="width"><xsl:value-of select="$svg-width - 1"/></xsl:attribute>
143 <xsl:attribute name="height"><xsl:value-of select="$hits-height + $header-height "/></xsl:attribute>
144 <xsl:attribute name="fill">whitesmoke</xsl:attribute>
145 <xsl:attribute name="stroke">blue</xsl:attribute>
146 </xsl:element>
147
148
149 <xsl:apply-templates select="BlastOutput"/>
150 </xsl:element>
151 <!-- end SVG figure -->
152
153 </h:div>
154 <h:hr/>
155 <xsl:apply-templates select="BlastOutput/BlastOutput_param/Parameters"/>
156 <h:hr/>
157 <h:p><h:b>SVG</h:b> figure generated with <h:a href="http://code.google.com/p/lindenb/source/browse/trunk/src/xsl/blast2svg.xsl">blast2svg</h:a>. <h:a href="http://plindenbaum.blogspot.com">Pierre Lindenbaum PhD</h:a> <h:i>( plindenbaum at yahoo dot fr )</h:i></h:p>
158
159 </h:body>
160 </h:html>
161 </xsl:template>
162 <!-- ========================================================================= -->
163 <!-- display parameters in a HTML table -->
164 <xsl:template match="Parameters">
165 <h:div>
166 <h:h3>Parameters</h:h3>
167 <h:table>
168 <h:tr><h:th>Expect</h:th><h:td><xsl:value-of select="Parameters_expect"/></h:td></h:tr>
169 <h:tr><h:th>Sc-match</h:th><h:td><xsl:value-of select="Parameters_sc-match"/></h:td></h:tr>
170 <h:tr><h:th>Sc-mismatch</h:th><h:td><xsl:value-of select="Parameters_sc-mismatch"/></h:td></h:tr>
171 <h:tr><h:th>Gap-open</h:th><h:td><xsl:value-of select="Parameters_gap-open"/></h:td></h:tr>
172 <h:tr><h:th>Gap-extend</h:th><h:td><xsl:value-of select="Parameters_gap-extend"/></h:td></h:tr>
173 <h:tr><h:th>Filter</h:th><h:td><xsl:value-of select="Parameters_filter"/></h:td></h:tr>
174 </h:table>
175 </h:div>
176 </xsl:template>
177
178
179 <!-- ========================================================================= -->
180 <xsl:template match="BlastOutput">
181 <!-- paint header -->
182 <svg:g>
183 <xsl:element name="svg:rect">
184 <xsl:attribute name="x">0</xsl:attribute>
185 <xsl:attribute name="y">0</xsl:attribute>
186 <xsl:attribute name="width"><xsl:value-of select="$svg-width - 1"/></xsl:attribute>
187 <xsl:attribute name="height"><xsl:value-of select="$header-height - 2"/></xsl:attribute>
188 <xsl:attribute name="fill">url(#score5)</xsl:attribute>
189 <xsl:attribute name="stroke">black</xsl:attribute>
190 </xsl:element>
191
192 <xsl:element name="svg:text">
193 <xsl:attribute name="x"><xsl:value-of select="$svg-width div 2"/></xsl:attribute>
194 <xsl:attribute name="y"><xsl:value-of select="$header-height div 2"/></xsl:attribute>
195 <xsl:attribute name="class">title</xsl:attribute>
196 <xsl:value-of select="BlastOutput_query-def"/> (len=<xsl:value-of select="BlastOutput_query-len"/> )
197 </xsl:element>
198 </svg:g>
199 <xsl:apply-templates select="BlastOutput_iterations/Iteration[1]/Iteration_hits"/>
200 </xsl:template>
201
202 <!-- ========================================================================= -->
203
204 <xsl:template match="Iteration_hits">
205 <xsl:apply-templates select="Hit"/>
206 </xsl:template>
207
208 <!-- ========================================================================= -->
209
210 <xsl:template match="Hit">
211 <!-- count number of preceding hits -->
212 <xsl:variable name="preceding-hits"><xsl:value-of select="count(preceding-sibling::Hit)"/></xsl:variable>
213 <!-- count number of preceding hsp -->
214 <xsl:variable name="preceding-hsp"><xsl:value-of select="count(preceding-sibling::Hit/Hit_hsps/Hsp)"/></xsl:variable>
215 <!-- calculate hieght of this part -->
216 <xsl:variable name="height"><xsl:value-of select="count(Hit_hsps/Hsp)*$hsp-height"/></xsl:variable>
217 <!-- translate this part verticaly -->
218 <xsl:element name="svg:g">
219 <xsl:attribute name="transform">translate(0,<xsl:value-of select="$header-height + $preceding-hsp * $hsp-height + ($preceding-hits + 1) * $space-between-hits "/>)</xsl:attribute>
220 <xsl:attribute name="id">hit-<xsl:value-of select="generate-id(.)"/></xsl:attribute>
221 <xsl:element name="svg:text">
222 <xsl:attribute name="x"><xsl:value-of select="$svg-width div 2"/></xsl:attribute>
223 <xsl:attribute name="y"><xsl:value-of select="-2"/></xsl:attribute>
224 <xsl:attribute name="class">t2</xsl:attribute>
225 <xsl:value-of select="Hit_def"/>
226 </xsl:element>
227 <xsl:element name="svg:rect">
228 <xsl:attribute name="x">0</xsl:attribute>
229 <xsl:attribute name="y">0</xsl:attribute>
230 <xsl:attribute name="width"><xsl:value-of select="$svg-width"/></xsl:attribute>
231 <xsl:attribute name="height"><xsl:value-of select="$height"/></xsl:attribute>
232 <xsl:attribute name="class">hit</xsl:attribute>
233 </xsl:element>
234
235 <xsl:call-template name="grid">
236 <xsl:with-param name="x" select="0"/>
237 <xsl:with-param name="d" select="20"/>
238 <xsl:with-param name="W" select="$svg-width"/>
239 <xsl:with-param name="H" select="$height"/>
240 </xsl:call-template>
241
242 <xsl:apply-templates select="Hit_hsps"/>
243
244
245
246 </xsl:element>
247 </xsl:template>
248
249 <!-- ========================================================================= -->
250 <!-- draw vertical lines , recursive template -->
251 <xsl:template name="grid">
252 <xsl:param name="x" select="0" />
253 <xsl:param name="d" select="20" />
254 <xsl:param name="W" select="0" />
255 <xsl:param name="H" select="0" />
256 <svg:line class="grid" x1="{$x}" x2="{$x}" y1="0" y2="{$H}"/>
257 <xsl:if test="$d + $x < $W">
258 <xsl:call-template name="grid">
259 <xsl:with-param name="x" select="$d + $x"/>
260 <xsl:with-param name="d" select="$d"/>
261 <xsl:with-param name="W" select="$W"/>
262 <xsl:with-param name="H" select="$H"/>
263 </xsl:call-template>
264 </xsl:if>
265 </xsl:template>
266
267 <!-- ========================================================================= -->
268
269 <xsl:template match="Hit_hsps">
270 <xsl:apply-templates select="Hsp"/>
271 </xsl:template>
272
273
274 <!-- ========================================================================= -->
275 <xsl:template match="Hsp">
276 <!-- number of previous hsp in the same Hit -->
277 <xsl:variable name="preceding-hsp"><xsl:value-of select="count(preceding-sibling::Hsp)"/></xsl:variable>
278 <!-- get the 5' position of the hsp in the query -->
279 <xsl:variable name="hsp-left"><xsl:choose>
280 <xsl:when test="Hsp_query-from < Hsp_query-to"><xsl:value-of select="Hsp_query-from"/></xsl:when>
281 <xsl:otherwise><xsl:value-of select="Hsp_query-to"/></xsl:otherwise>
282 </xsl:choose></xsl:variable>
283 <!-- get the 3' position of the hsp in the query -->
284 <xsl:variable name="hsp-right"><xsl:choose>
285 <xsl:when test="Hsp_query-from < Hsp_query-to"><xsl:value-of select="Hsp_query-to"/></xsl:when>
286 <xsl:otherwise><xsl:value-of select="Hsp_query-from"/></xsl:otherwise>
287 </xsl:choose></xsl:variable>
288 <!-- 5' position on screen -->
289 <xsl:variable name="x1"><xsl:value-of select="($hsp-left div $query-length ) * $svg-width"/></xsl:variable>
290 <!-- 3' position on screen -->
291 <xsl:variable name="x2"><xsl:value-of select="($hsp-right div $query-length ) * $svg-width"/></xsl:variable>
292 <!-- label -->
293 <xsl:variable name="label"><xsl:value-of select="Hsp_hit-from"/> - <xsl:value-of select="Hsp_hit-to"/> (<xsl:choose>
294 <xsl:when test="Hsp_query-from < Hsp_query-to">+</xsl:when>
295 <xsl:otherwise>-</xsl:otherwise></xsl:choose>) e=<xsl:value-of select="Hsp_evalue"/></xsl:variable>
296
297 <!-- translate this Hsp verticaly in its Hit -->
298 <xsl:element name="svg:g">
299 <xsl:attribute name="transform">translate(0,<xsl:value-of select="$preceding-hsp * $hsp-height"/>)</xsl:attribute>
300 <xsl:attribute name="id">hsp-<xsl:value-of select="generate-id(.)"/></xsl:attribute>
301 <xsl:attribute name="title"><xsl:value-of select="Hsp_evalue"/></xsl:attribute>
302
303 <!-- paint the Hsp Rectangle -->
304 <xsl:element name="svg:rect">
305 <xsl:attribute name="x"><xsl:value-of select="$x1"/></xsl:attribute>
306 <xsl:attribute name="y">2</xsl:attribute>
307 <xsl:attribute name="width"><xsl:value-of select="$x2 - $x1"/></xsl:attribute>
308 <xsl:attribute name="height"><xsl:value-of select="$hsp-height - 4"/></xsl:attribute>
309 <!-- choose a color according to the e-value -->
310 <xsl:attribute name="fill"><xsl:choose>
311 <xsl:when test="Hsp_evalue < 1E-100">url(#score1)</xsl:when>
312 <xsl:when test="Hsp_evalue < 1E-10">url(#score2)</xsl:when>
313 <xsl:when test="Hsp_evalue < 0.1">url(#score3)</xsl:when>
314 <xsl:when test="Hsp_evalue < 0">url(#score4)</xsl:when>
315 <xsl:otherwise>url(#score5)</xsl:otherwise>
316 </xsl:choose></xsl:attribute>
317 </xsl:element>
318
319 <!-- paint the label according to the position of the Hsp on screen -->
320 <xsl:choose>
321 <xsl:when test="$x2 < (0.75 * $svg-width)">
322 <xsl:element name="svg:text">
323 <xsl:attribute name="class">t1</xsl:attribute>
324 <xsl:attribute name="x"><xsl:value-of select="$x2 + 10 "/></xsl:attribute>
325 <xsl:attribute name="y"><xsl:value-of select="$hsp-height -1"/></xsl:attribute>
326 <xsl:attribute name="text-anchor">start</xsl:attribute>
327 <xsl:value-of select="$label"/>
328 </xsl:element>
329 </xsl:when>
330 <xsl:when test="$x1 > (0.25 * $svg-width)">
331 <xsl:element name="svg:text">
332 <xsl:attribute name="class">t1</xsl:attribute>
333 <xsl:attribute name="x"><xsl:value-of select="$x1 - 10 "/></xsl:attribute>
334 <xsl:attribute name="y"><xsl:value-of select="$hsp-height -1"/></xsl:attribute>
335 <xsl:attribute name="text-anchor">end</xsl:attribute>
336 <xsl:value-of select="$label"/>
337 </xsl:element>
338 </xsl:when>
339 <xsl:otherwise>
340 <xsl:element name="svg:text">
341 <xsl:attribute name="class">t1</xsl:attribute>
342 <xsl:attribute name="x"><xsl:value-of select="($x2 - $x1) div 2 "/></xsl:attribute>
343 <xsl:attribute name="y"><xsl:value-of select="$hsp-height -1"/></xsl:attribute>
344 <xsl:attribute name="text-anchor">middle</xsl:attribute>
345 <xsl:value-of select="$label"/>
346 </xsl:element>
347 </xsl:otherwise>
348 </xsl:choose>
349
350 </xsl:element>
351 </xsl:template>
352 <!-- ========================================================================= -->
353
354
355 </xsl:stylesheet>
Some random notes:
Line 22-38: I define a few variables such as the number of Hsp or the number of Hits
Line 43: matching the root., we start the XHTML document here
line 73: we start the SVG document here. It is embedded in the XHTML document
line 80-110: CSS can be used for SVG
line 112-137: we define a few gradients to colorize the Hsp. TODO: finding a better method to colorize according to its e-value/score
line 199: for the first iteration, the <Hit> templates are called
line 211: we need to count the number of preceding hits/hsp to know how much we should translate vertically this group of object
line 242: we loop over each hsp in this hit
line 276-292: again, we need to know the number of preceding hits/hsp to translate this hsp vertically. We also calculate the 5' and the 3' position of the Hit in the query.
line 304-307: here, we paint the hsp-rectangle
line 320-348: lousy method, we paint a label for this hsp, trying to find the best place (left/right/middle) to print the label.
The blast file was processed with xsltproc:
xsltproc --novalid blast2svg.xsl blast.xml > ~/blast.xhtml
A sample output is displayed below
Pierre
